Incidental Mutation 'R3777:Man2b2'
ID271831
Institutional Source Beutler Lab
Gene Symbol Man2b2
Ensembl Gene ENSMUSG00000029119
Gene Namemannosidase 2, alpha B2
Synonyms135 kDa alpha-D-mannosidase
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3777 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location36806921-36830653 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36815527 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 548 (N548D)
Ref Sequence ENSEMBL: ENSMUSP00000031002 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031002]
Predicted Effect probably benign
Transcript: ENSMUST00000031002
AA Change: N548D

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000031002
Gene: ENSMUSG00000029119
AA Change: N548D

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Glyco_hydro_38 28 351 4e-100 PFAM
Alpha-mann_mid 356 439 3.3e-20 SMART
Pfam:Glyco_hydro_38C 487 1013 2e-98 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000124711
AA Change: N127D
SMART Domains Protein: ENSMUSP00000115495
Gene: ENSMUSG00000029119
AA Change: N127D

DomainStartEndE-ValueType
Pfam:Glyco_hydro_38C 67 469 2.5e-80 PFAM
low complexity region 483 493 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147893
SMART Domains Protein: ENSMUSP00000114319
Gene: ENSMUSG00000029119

DomainStartEndE-ValueType
Pfam:Glyco_hydro_38C 2 86 4.2e-8 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik T C 10: 22,066,962 E373G probably damaging Het
Dsg1b G A 18: 20,399,587 V563I probably damaging Het
Elovl4 ACT A 9: 83,785,148 probably null Het
Erp27 A T 6: 136,919,903 N100K possibly damaging Het
Fam171b T A 2: 83,878,261 I369K probably benign Het
Fmn1 A G 2: 113,365,122 E389G unknown Het
Gm14569 T A X: 36,432,432 M875L probably benign Het
Gm5819 A G 18: 8,694,429 E118G probably damaging Het
Grip1 G A 10: 119,985,630 probably null Het
Heatr1 C A 13: 12,413,348 L789I possibly damaging Het
Hsd17b1 T C 11: 101,078,703 S59P probably damaging Het
Ighv1-72 A T 12: 115,758,016 S107T probably damaging Het
Inpp4b T A 8: 82,041,992 V710D possibly damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Larp4 T A 15: 99,990,357 W92R probably damaging Het
Mfsd4b2 A G 10: 39,921,531 I276T possibly damaging Het
Mki67 A C 7: 135,696,130 S2392A probably benign Het
Myl12a G T 17: 70,994,636 H165Q possibly damaging Het
Myo18b T A 5: 112,757,596 E2045D probably damaging Het
Mypn T C 10: 63,147,982 T496A possibly damaging Het
Ncoa7 A G 10: 30,689,756 Y632H probably damaging Het
Olfr142 T C 2: 90,252,625 Y121C probably damaging Het
Olfr273 A T 4: 52,855,636 N292K probably damaging Het
Olfr472 C A 7: 107,902,747 A10E probably benign Het
Olfr710 A T 7: 106,944,312 S230T probably benign Het
Olfr952 A T 9: 39,426,605 S155R possibly damaging Het
Pik3c2g A T 6: 139,622,387 Y167F probably damaging Het
Pik3cg A C 12: 32,194,709 C915W probably damaging Het
Ppfibp2 A G 7: 107,729,189 T476A probably benign Het
Rapgef1 C T 2: 29,719,689 H675Y possibly damaging Het
Rpn2 T A 2: 157,299,557 V263D probably damaging Het
Rps13 A G 7: 116,333,925 L16P probably damaging Het
Rsph14 C G 10: 74,957,587 Q360H possibly damaging Het
Rsph14 T G 10: 74,957,588 Q360P possibly damaging Het
Smarcc2 G A 10: 128,482,943 probably null Het
Sp8 G T 12: 118,849,015 V202L possibly damaging Het
Spag9 G A 11: 94,099,026 probably null Het
Svil A G 18: 5,090,855 N915S probably damaging Het
Syt17 A G 7: 118,433,957 L215P probably damaging Het
Tle6 G T 10: 81,596,153 P86T probably benign Het
Tph2 T C 10: 115,080,005 D421G probably benign Het
Trpm2 A C 10: 77,935,990 L605R probably benign Het
Vat1l T C 8: 114,236,800 probably null Het
Vdac3 T C 8: 22,580,509 N128D probably benign Het
Vegfb G A 19: 6,987,399 probably benign Het
Zfp808 T A 13: 62,171,903 N315K probably damaging Het
Other mutations in Man2b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00970:Man2b2 APN 5 36816143 nonsense probably null
IGL01098:Man2b2 APN 5 36815556 missense probably damaging 1.00
IGL01367:Man2b2 APN 5 36814337 nonsense probably null
IGL01781:Man2b2 APN 5 36813745 missense possibly damaging 0.80
IGL01809:Man2b2 APN 5 36814516 missense probably benign 0.01
IGL02824:Man2b2 APN 5 36821851 missense probably benign 0.09
IGL03323:Man2b2 APN 5 36818514 missense probably benign 0.07
IGL03333:Man2b2 APN 5 36816139 missense probably damaging 0.96
R0505:Man2b2 UTSW 5 36816198 missense probably benign 0.00
R0715:Man2b2 UTSW 5 36826058 missense probably benign 0.00
R1435:Man2b2 UTSW 5 36813067 missense probably damaging 0.98
R1536:Man2b2 UTSW 5 36820927 missense probably benign 0.10
R1944:Man2b2 UTSW 5 36816180 missense probably benign
R2079:Man2b2 UTSW 5 36814372 missense possibly damaging 0.64
R2475:Man2b2 UTSW 5 36807875 missense probably benign 0.01
R2924:Man2b2 UTSW 5 36824102 missense probably benign 0.01
R2925:Man2b2 UTSW 5 36824102 missense probably benign 0.01
R2938:Man2b2 UTSW 5 36820986 missense probably benign 0.27
R3778:Man2b2 UTSW 5 36815527 missense probably benign 0.00
R3982:Man2b2 UTSW 5 36813820 missense probably benign 0.10
R4618:Man2b2 UTSW 5 36817639 missense probably benign 0.06
R4822:Man2b2 UTSW 5 36815521 missense probably damaging 1.00
R5320:Man2b2 UTSW 5 36810333 missense probably damaging 1.00
R5394:Man2b2 UTSW 5 36814518 missense probably benign 0.03
R5468:Man2b2 UTSW 5 36807175 missense probably benign 0.00
R5993:Man2b2 UTSW 5 36820980 missense probably benign 0.12
R6053:Man2b2 UTSW 5 36813038 missense probably benign 0.00
R6083:Man2b2 UTSW 5 36809041 missense probably damaging 1.00
R6376:Man2b2 UTSW 5 36821034 missense probably damaging 1.00
R6669:Man2b2 UTSW 5 36810358 missense probably benign 0.00
R7000:Man2b2 UTSW 5 36821869 missense probably damaging 1.00
R7108:Man2b2 UTSW 5 36815485 missense probably benign 0.04
R7376:Man2b2 UTSW 5 36813378 missense probably damaging 1.00
R7478:Man2b2 UTSW 5 36810313 missense probably damaging 1.00
R7712:Man2b2 UTSW 5 36810314 missense probably benign 0.00
R8059:Man2b2 UTSW 5 36816160 missense probably damaging 1.00
X0022:Man2b2 UTSW 5 36813892 missense probably damaging 0.99
Z1088:Man2b2 UTSW 5 36815356 missense possibly damaging 0.46
Z1177:Man2b2 UTSW 5 36813797 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACATGTTGGTGTCCTGGTC -3'
(R):5'- TGTAGCCTGTAAAGATGGCATGG -3'

Sequencing Primer
(F):5'- TGGTGTCCTGGTCGAACAGC -3'
(R):5'- CTGTAAAGATGGCATGGGAATCCTC -3'
Posted On2015-03-25