Mutagenetix > Incidental Mutation

Incidental Mutation 'R3777:Heatr1'

271863

Institutional Source

Beutler Lab

Gene Symbol

Heatr1

Ensembl Gene

ENSMUSG00000050244

Gene Name

HEAT repeat containing 1

Synonyms

B130016L12Rik

Accession Numbers

Essential gene?

Probably essential (E-score: 0.969) question?

Stock #

R3777 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

12395027-12440289 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 12413348 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Isoleucine at position 789 (L789I)

Ref Sequence

ENSEMBL: ENSMUSP00000054084 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000059270]

AlphaFold

G3X9B1

Predicted Effect

possibly damaging
Transcript: ENSMUST00000059270
AA Change: L789I

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000054084
Gene: ENSMUSG00000050244
AA Change: L789I

Domain	Start	End	E-Value	Type
low complexity region	4	15	N/A	INTRINSIC
Pfam:U3snoRNP10	238	354	7e-30	PFAM
SCOP:d1qbkb_	919	1795	3e-8	SMART
low complexity region	1805	1814	N/A	INTRINSIC
BP28CT	1856	2009	2.25e-77	SMART
Blast:BP28CT	2015	2061	2e-15	BLAST
coiled coil region	2109	2137	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221746

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.7%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930444G20Rik	T	C	10: 22,066,962	E373G	probably damaging	Het
Dsg1b	G	A	18: 20,399,587	V563I	probably damaging	Het
Elovl4	ACT	A	9: 83,785,148		probably null	Het
Erp27	A	T	6: 136,919,903	N100K	possibly damaging	Het
Fam171b	T	A	2: 83,878,261	I369K	probably benign	Het
Fmn1	A	G	2: 113,365,122	E389G	unknown	Het
Gm14569	T	A	X: 36,432,432	M875L	probably benign	Het
Gm5819	A	G	18: 8,694,429	E118G	probably damaging	Het
Grip1	G	A	10: 119,985,630		probably null	Het
Hsd17b1	T	C	11: 101,078,703	S59P	probably damaging	Het
Ighv1-72	A	T	12: 115,758,016	S107T	probably damaging	Het
Inpp4b	T	A	8: 82,041,992	V710D	possibly damaging	Het
Kcnd3	C	T	3: 105,658,766	A421V	probably damaging	Het
Larp4	T	A	15: 99,990,357	W92R	probably damaging	Het
Man2b2	T	C	5: 36,815,527	N548D	probably benign	Het
Mfsd4b2	A	G	10: 39,921,531	I276T	possibly damaging	Het
Mki67	A	C	7: 135,696,130	S2392A	probably benign	Het
Myl12a	G	T	17: 70,994,636	H165Q	possibly damaging	Het
Myo18b	T	A	5: 112,757,596	E2045D	probably damaging	Het
Mypn	T	C	10: 63,147,982	T496A	possibly damaging	Het
Ncoa7	A	G	10: 30,689,756	Y632H	probably damaging	Het
Olfr142	T	C	2: 90,252,625	Y121C	probably damaging	Het
Olfr273	A	T	4: 52,855,636	N292K	probably damaging	Het
Olfr472	C	A	7: 107,902,747	A10E	probably benign	Het
Olfr710	A	T	7: 106,944,312	S230T	probably benign	Het
Olfr952	A	T	9: 39,426,605	S155R	possibly damaging	Het
Pik3c2g	A	T	6: 139,622,387	Y167F	probably damaging	Het
Pik3cg	A	C	12: 32,194,709	C915W	probably damaging	Het
Ppfibp2	A	G	7: 107,729,189	T476A	probably benign	Het
Rapgef1	C	T	2: 29,719,689	H675Y	possibly damaging	Het
Rpn2	T	A	2: 157,299,557	V263D	probably damaging	Het
Rps13	A	G	7: 116,333,925	L16P	probably damaging	Het
Rsph14	C	G	10: 74,957,587	Q360H	possibly damaging	Het
Rsph14	T	G	10: 74,957,588	Q360P	possibly damaging	Het
Smarcc2	G	A	10: 128,482,943		probably null	Het
Sp8	G	T	12: 118,849,015	V202L	possibly damaging	Het
Spag9	G	A	11: 94,099,026		probably null	Het
Svil	A	G	18: 5,090,855	N915S	probably damaging	Het
Syt17	A	G	7: 118,433,957	L215P	probably damaging	Het
Tle6	G	T	10: 81,596,153	P86T	probably benign	Het
Tph2	T	C	10: 115,080,005	D421G	probably benign	Het
Trpm2	A	C	10: 77,935,990	L605R	probably benign	Het
Vat1l	T	C	8: 114,236,800		probably null	Het
Vdac3	T	C	8: 22,580,509	N128D	probably benign	Het
Vegfb	G	A	19: 6,987,399		probably benign	Het
Zfp808	T	A	13: 62,171,903	N315K	probably damaging	Het

Other mutations in Heatr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00666:Heatr1	APN	13	12410450	missense	probably benign	0.00
IGL00863:Heatr1	APN	13	12435128	missense	probably benign	0.02
IGL00899:Heatr1	APN	13	12435176	missense	probably benign	0.31
IGL01147:Heatr1	APN	13	12437912	missense	probably damaging	0.99
IGL01317:Heatr1	APN	13	12399027	missense	probably damaging	1.00
IGL01323:Heatr1	APN	13	12398938	missense	possibly damaging	0.86
IGL01625:Heatr1	APN	13	12413528	missense	probably damaging	0.98
IGL01973:Heatr1	APN	13	12429799	missense	probably benign
IGL02803:Heatr1	APN	13	12433986	missense	probably damaging	0.96
IGL02830:Heatr1	APN	13	12426212	missense	possibly damaging	0.57
IGL02956:Heatr1	APN	13	12416059	missense	possibly damaging	0.53
IGL03000:Heatr1	APN	13	12434411	missense	probably damaging	0.99
IGL03024:Heatr1	APN	13	12407509	unclassified	probably benign
IGL03035:Heatr1	APN	13	12413219	splice site	probably benign
IGL03301:Heatr1	APN	13	12434205	missense	probably damaging	1.00
hasan	UTSW	13	12417447	splice site	probably benign
H8562:Heatr1	UTSW	13	12408713	missense	probably benign	0.13
R0226:Heatr1	UTSW	13	12410562	missense	probably damaging	1.00
R0571:Heatr1	UTSW	13	12430240	missense	probably damaging	0.98
R0722:Heatr1	UTSW	13	12406037	missense	probably benign	0.14
R1264:Heatr1	UTSW	13	12424610	unclassified	probably benign
R1371:Heatr1	UTSW	13	12417632	missense	possibly damaging	0.80
R1388:Heatr1	UTSW	13	12417447	splice site	probably benign
R1396:Heatr1	UTSW	13	12406046	missense	possibly damaging	0.86
R1519:Heatr1	UTSW	13	12412159	missense	probably benign
R1689:Heatr1	UTSW	13	12424625	missense	probably benign	0.00
R1696:Heatr1	UTSW	13	12423721	missense	possibly damaging	0.96
R1756:Heatr1	UTSW	13	12396460	missense	probably benign	0.01
R1859:Heatr1	UTSW	13	12403159	missense	probably damaging	1.00
R1932:Heatr1	UTSW	13	12435185	missense	probably damaging	1.00
R1957:Heatr1	UTSW	13	12396538	missense	probably damaging	1.00
R2018:Heatr1	UTSW	13	12414478	missense	possibly damaging	0.68
R2106:Heatr1	UTSW	13	12412058	missense	probably benign	0.03
R2119:Heatr1	UTSW	13	12432646	missense	probably null	1.00
R2121:Heatr1	UTSW	13	12403264	missense	probably benign	0.10
R2122:Heatr1	UTSW	13	12403264	missense	probably benign	0.10
R2367:Heatr1	UTSW	13	12433724	missense	probably damaging	1.00
R3783:Heatr1	UTSW	13	12434460	missense	probably damaging	1.00
R3784:Heatr1	UTSW	13	12434460	missense	probably damaging	1.00
R3786:Heatr1	UTSW	13	12434460	missense	probably damaging	1.00
R3787:Heatr1	UTSW	13	12434460	missense	probably damaging	1.00
R3843:Heatr1	UTSW	13	12435121	missense	probably benign	0.00
R4533:Heatr1	UTSW	13	12434511	missense	probably benign	0.05
R4725:Heatr1	UTSW	13	12424662	nonsense	probably null
R4763:Heatr1	UTSW	13	12430930	missense	possibly damaging	0.65
R4793:Heatr1	UTSW	13	12431837	missense	probably benign	0.00
R4797:Heatr1	UTSW	13	12412048	missense	probably benign	0.36
R4798:Heatr1	UTSW	13	12412048	missense	probably benign	0.36
R4942:Heatr1	UTSW	13	12413510	critical splice acceptor site	probably null
R4952:Heatr1	UTSW	13	12410599	missense	probably benign	0.38
R4954:Heatr1	UTSW	13	12407516	critical splice acceptor site	probably null
R5370:Heatr1	UTSW	13	12401522	missense	probably benign	0.02
R5464:Heatr1	UTSW	13	12433643	missense	probably benign	0.00
R5483:Heatr1	UTSW	13	12398914	missense	probably damaging	1.00
R5497:Heatr1	UTSW	13	12421064	missense	possibly damaging	0.93
R5504:Heatr1	UTSW	13	12406619	missense	possibly damaging	0.64
R5527:Heatr1	UTSW	13	12402760	missense	probably damaging	1.00
R5527:Heatr1	UTSW	13	12404948	missense	probably benign
R5836:Heatr1	UTSW	13	12408736	missense	probably damaging	0.99
R5916:Heatr1	UTSW	13	12434471	missense	probably damaging	1.00
R6018:Heatr1	UTSW	13	12404947	missense	probably benign
R6018:Heatr1	UTSW	13	12406058	missense	probably benign	0.26
R6216:Heatr1	UTSW	13	12432664	missense	probably benign	0.16
R6396:Heatr1	UTSW	13	12406097	missense	possibly damaging	0.86
R6472:Heatr1	UTSW	13	12434230	missense	probably benign	0.29
R6922:Heatr1	UTSW	13	12435075	missense	probably benign	0.00
R7077:Heatr1	UTSW	13	12418164	missense	possibly damaging	0.63
R7297:Heatr1	UTSW	13	12421060	nonsense	probably null
R7445:Heatr1	UTSW	13	12431038	missense	possibly damaging	0.70
R7669:Heatr1	UTSW	13	12411262	missense	probably benign	0.33
R7672:Heatr1	UTSW	13	12438664	missense	probably damaging	0.96
R7772:Heatr1	UTSW	13	12417641	missense	probably benign	0.03
R8205:Heatr1	UTSW	13	12416047	missense	probably benign
R8518:Heatr1	UTSW	13	12410534	missense	probably benign
R8754:Heatr1	UTSW	13	12413294	missense	probably damaging	0.99
R8874:Heatr1	UTSW	13	12430912	missense	probably damaging	1.00
R8992:Heatr1	UTSW	13	12401114	missense	probably damaging	0.98
R9045:Heatr1	UTSW	13	12413352	missense	probably benign	0.00
R9077:Heatr1	UTSW	13	12413366	missense	probably benign
R9183:Heatr1	UTSW	13	12421385	missense	probably damaging	0.99
R9186:Heatr1	UTSW	13	12421346	missense	probably damaging	1.00
R9223:Heatr1	UTSW	13	12404921	missense	probably benign	0.00
R9242:Heatr1	UTSW	13	12433925	missense	probably benign
R9267:Heatr1	UTSW	13	12406608	missense	probably damaging	1.00
R9289:Heatr1	UTSW	13	12432727	missense	probably benign	0.13
R9310:Heatr1	UTSW	13	12438610	missense	probably benign
R9312:Heatr1	UTSW	13	12431684	missense	probably benign
R9358:Heatr1	UTSW	13	12418206	missense	probably benign	0.09
R9385:Heatr1	UTSW	13	12406542	missense	probably damaging	1.00
R9530:Heatr1	UTSW	13	12424726	missense	probably damaging	1.00
R9532:Heatr1	UTSW	13	12414425	missense	possibly damaging	0.72
R9647:Heatr1	UTSW	13	12426798	missense	probably benign	0.00
R9683:Heatr1	UTSW	13	12434259	missense	probably damaging	1.00
R9695:Heatr1	UTSW	13	12423743	missense	probably damaging	1.00
RF011:Heatr1	UTSW	13	12407544	missense	probably benign	0.00
Z1176:Heatr1	UTSW	13	12399008	missense	possibly damaging	0.68

Predicted Primers

PCR Primer
(F):5'- AGTGCGTATCCGTTGCAGTC -3'
(R):5'- TCATCTAGCTGCTCGGGATTC -3'

Sequencing Primer
(F):5'- ATCCGTTGCAGTCATAGAGC -3'
(R):5'- TGCTCGGGATTCCACCACATG -3'

Posted On

2015-03-25