Incidental Mutation 'R3777:Zfp808'
ID271864
Institutional Source Beutler Lab
Gene Symbol Zfp808
Ensembl Gene ENSMUSG00000074867
Gene Namezinc finger protein 808
SynonymsGm7036
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R3777 (G1)
Quality Score147
Status Not validated
Chromosome13
Chromosomal Location62129886-62236144 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 62171903 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 315 (N315K)
Ref Sequence ENSEMBL: ENSMUSP00000097048 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099449] [ENSMUST00000221772]
Predicted Effect probably damaging
Transcript: ENSMUST00000099449
AA Change: N315K

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000097048
Gene: ENSMUSG00000074867
AA Change: N315K

DomainStartEndE-ValueType
KRAB 4 66 2.1e-17 SMART
ZnF_C2H2 133 155 2.4e-3 SMART
ZnF_C2H2 161 183 8.34e-3 SMART
ZnF_C2H2 189 211 2.75e-3 SMART
ZnF_C2H2 217 239 1.98e-4 SMART
ZnF_C2H2 245 267 3.21e-4 SMART
ZnF_C2H2 273 295 2.43e-4 SMART
ZnF_C2H2 301 323 8.6e-5 SMART
ZnF_C2H2 329 351 4.54e-4 SMART
ZnF_C2H2 357 379 9.22e-5 SMART
ZnF_C2H2 385 407 8.22e-2 SMART
ZnF_C2H2 413 435 1.56e-2 SMART
ZnF_C2H2 441 463 5.99e-4 SMART
ZnF_C2H2 469 491 2.79e-4 SMART
ZnF_C2H2 497 519 4.54e-4 SMART
ZnF_C2H2 525 547 1.95e-3 SMART
ZnF_C2H2 553 575 4.24e-4 SMART
ZnF_C2H2 581 603 2.27e-4 SMART
ZnF_C2H2 609 631 2.27e-4 SMART
ZnF_C2H2 637 659 9.08e-4 SMART
ZnF_C2H2 665 687 1.4e-4 SMART
ZnF_C2H2 693 715 4.24e-4 SMART
ZnF_C2H2 721 743 1.26e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221542
Predicted Effect probably benign
Transcript: ENSMUST00000221772
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222809
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222947
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223094
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik T C 10: 22,066,962 E373G probably damaging Het
Dsg1b G A 18: 20,399,587 V563I probably damaging Het
Elovl4 ACT A 9: 83,785,148 probably null Het
Erp27 A T 6: 136,919,903 N100K possibly damaging Het
Fam171b T A 2: 83,878,261 I369K probably benign Het
Fmn1 A G 2: 113,365,122 E389G unknown Het
Gm14569 T A X: 36,432,432 M875L probably benign Het
Gm5819 A G 18: 8,694,429 E118G probably damaging Het
Grip1 G A 10: 119,985,630 probably null Het
Heatr1 C A 13: 12,413,348 L789I possibly damaging Het
Hsd17b1 T C 11: 101,078,703 S59P probably damaging Het
Ighv1-72 A T 12: 115,758,016 S107T probably damaging Het
Inpp4b T A 8: 82,041,992 V710D possibly damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Larp4 T A 15: 99,990,357 W92R probably damaging Het
Man2b2 T C 5: 36,815,527 N548D probably benign Het
Mfsd4b2 A G 10: 39,921,531 I276T possibly damaging Het
Mki67 A C 7: 135,696,130 S2392A probably benign Het
Myl12a G T 17: 70,994,636 H165Q possibly damaging Het
Myo18b T A 5: 112,757,596 E2045D probably damaging Het
Mypn T C 10: 63,147,982 T496A possibly damaging Het
Ncoa7 A G 10: 30,689,756 Y632H probably damaging Het
Olfr142 T C 2: 90,252,625 Y121C probably damaging Het
Olfr273 A T 4: 52,855,636 N292K probably damaging Het
Olfr472 C A 7: 107,902,747 A10E probably benign Het
Olfr710 A T 7: 106,944,312 S230T probably benign Het
Olfr952 A T 9: 39,426,605 S155R possibly damaging Het
Pik3c2g A T 6: 139,622,387 Y167F probably damaging Het
Pik3cg A C 12: 32,194,709 C915W probably damaging Het
Ppfibp2 A G 7: 107,729,189 T476A probably benign Het
Rapgef1 C T 2: 29,719,689 H675Y possibly damaging Het
Rpn2 T A 2: 157,299,557 V263D probably damaging Het
Rps13 A G 7: 116,333,925 L16P probably damaging Het
Rsph14 C G 10: 74,957,587 Q360H possibly damaging Het
Rsph14 T G 10: 74,957,588 Q360P possibly damaging Het
Smarcc2 G A 10: 128,482,943 probably null Het
Sp8 G T 12: 118,849,015 V202L possibly damaging Het
Spag9 G A 11: 94,099,026 probably null Het
Svil A G 18: 5,090,855 N915S probably damaging Het
Syt17 A G 7: 118,433,957 L215P probably damaging Het
Tle6 G T 10: 81,596,153 P86T probably benign Het
Tph2 T C 10: 115,080,005 D421G probably benign Het
Trpm2 A C 10: 77,935,990 L605R probably benign Het
Vat1l T C 8: 114,236,800 probably null Het
Vdac3 T C 8: 22,580,509 N128D probably benign Het
Vegfb G A 19: 6,987,399 probably benign Het
Other mutations in Zfp808
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01609:Zfp808 APN 13 62173209 missense probably damaging 0.96
IGL02517:Zfp808 APN 13 62173218 makesense probably null
IGL02809:Zfp808 APN 13 62173180 missense probably benign 0.00
IGL02882:Zfp808 APN 13 62173180 missense probably benign 0.00
IGL02941:Zfp808 APN 13 62173130 missense possibly damaging 0.82
IGL03184:Zfp808 APN 13 62169567 missense possibly damaging 0.90
LCD18:Zfp808 UTSW 13 62166651 intron probably benign
R0387:Zfp808 UTSW 13 62169478 missense probably damaging 1.00
R0472:Zfp808 UTSW 13 62172306 missense probably damaging 1.00
R0544:Zfp808 UTSW 13 62169434 splice site probably benign
R0635:Zfp808 UTSW 13 62172419 missense probably damaging 1.00
R0981:Zfp808 UTSW 13 62171673 missense possibly damaging 0.47
R1446:Zfp808 UTSW 13 62173007 missense probably damaging 1.00
R1569:Zfp808 UTSW 13 62172900 nonsense probably null
R1573:Zfp808 UTSW 13 62171497 missense possibly damaging 0.52
R1761:Zfp808 UTSW 13 62171646 missense possibly damaging 0.71
R1796:Zfp808 UTSW 13 62171856 missense probably damaging 1.00
R1993:Zfp808 UTSW 13 62172907 missense probably benign 0.10
R2656:Zfp808 UTSW 13 62172852 missense possibly damaging 0.63
R2938:Zfp808 UTSW 13 62171218 missense probably benign
R3027:Zfp808 UTSW 13 62171590 missense probably benign 0.33
R3779:Zfp808 UTSW 13 62171903 missense probably damaging 0.97
R3801:Zfp808 UTSW 13 62172083 missense probably damaging 1.00
R3802:Zfp808 UTSW 13 62172083 missense probably damaging 1.00
R3804:Zfp808 UTSW 13 62172083 missense probably damaging 1.00
R4024:Zfp808 UTSW 13 62171730 missense possibly damaging 0.71
R4741:Zfp808 UTSW 13 62171949 missense probably damaging 1.00
R4791:Zfp808 UTSW 13 62171231 missense probably damaging 0.97
R4809:Zfp808 UTSW 13 62171292 nonsense probably null
R4907:Zfp808 UTSW 13 62171473 missense possibly damaging 0.71
R5056:Zfp808 UTSW 13 62172630 missense probably damaging 1.00
R5760:Zfp808 UTSW 13 62171926 missense probably damaging 1.00
R5869:Zfp808 UTSW 13 62171255 missense probably damaging 1.00
R6230:Zfp808 UTSW 13 62172322 missense probably benign 0.19
R6372:Zfp808 UTSW 13 62172477 missense probably damaging 1.00
R6545:Zfp808 UTSW 13 62171895 missense probably benign 0.02
R6620:Zfp808 UTSW 13 62172824 missense probably benign 0.08
R6622:Zfp808 UTSW 13 62171832 missense possibly damaging 0.90
R6813:Zfp808 UTSW 13 62173035 missense probably damaging 0.99
R6920:Zfp808 UTSW 13 62173168 missense probably benign 0.05
R7511:Zfp808 UTSW 13 62172823 missense probably benign
R7666:Zfp808 UTSW 13 62171411 missense probably benign
R7747:Zfp808 UTSW 13 62171505 missense probably benign 0.39
R7763:Zfp808 UTSW 13 62172664 missense probably benign 0.28
R7779:Zfp808 UTSW 13 62172757 missense possibly damaging 0.68
RF005:Zfp808 UTSW 13 62171299 missense probably benign 0.14
RF024:Zfp808 UTSW 13 62171299 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- GAGAAACCCTACAAATGTGATCAA -3'
(R):5'- GTAAGGCTTCTCTCCAGTATGTGTT -3'

Sequencing Primer
(F):5'- AACCTTTTCTGAGAAATGTCATCTCC -3'
(R):5'- ACATTTGTAGGGTTTCTCTCCAG -3'
Posted On2015-03-25