Incidental Mutation 'R3777:Dsg1b'
ID271870
Institutional Source Beutler Lab
Gene Symbol Dsg1b
Ensembl Gene ENSMUSG00000061928
Gene Namedesmoglein 1 beta
SynonymsDsg5
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3777 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location20376729-20410196 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 20399587 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 563 (V563I)
Ref Sequence ENSEMBL: ENSMUSP00000076026 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076737]
Predicted Effect probably damaging
Transcript: ENSMUST00000076737
AA Change: V563I

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000076026
Gene: ENSMUSG00000061928
AA Change: V563I

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 70 155 3.45e-14 SMART
CA 179 267 3.11e-21 SMART
CA 290 384 6.29e-8 SMART
CA 407 491 3.92e-1 SMART
low complexity region 523 541 N/A INTRINSIC
low complexity region 576 587 N/A INTRINSIC
low complexity region 593 601 N/A INTRINSIC
Pfam:Cadherin_C 662 784 1.6e-10 PFAM
low complexity region 789 802 N/A INTRINSIC
low complexity region 884 896 N/A INTRINSIC
low complexity region 984 1006 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik T C 10: 22,066,962 E373G probably damaging Het
Elovl4 ACT A 9: 83,785,148 probably null Het
Erp27 A T 6: 136,919,903 N100K possibly damaging Het
Fam171b T A 2: 83,878,261 I369K probably benign Het
Fmn1 A G 2: 113,365,122 E389G unknown Het
Gm14569 T A X: 36,432,432 M875L probably benign Het
Gm5819 A G 18: 8,694,429 E118G probably damaging Het
Grip1 G A 10: 119,985,630 probably null Het
Heatr1 C A 13: 12,413,348 L789I possibly damaging Het
Hsd17b1 T C 11: 101,078,703 S59P probably damaging Het
Ighv1-72 A T 12: 115,758,016 S107T probably damaging Het
Inpp4b T A 8: 82,041,992 V710D possibly damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Larp4 T A 15: 99,990,357 W92R probably damaging Het
Man2b2 T C 5: 36,815,527 N548D probably benign Het
Mfsd4b2 A G 10: 39,921,531 I276T possibly damaging Het
Mki67 A C 7: 135,696,130 S2392A probably benign Het
Myl12a G T 17: 70,994,636 H165Q possibly damaging Het
Myo18b T A 5: 112,757,596 E2045D probably damaging Het
Mypn T C 10: 63,147,982 T496A possibly damaging Het
Ncoa7 A G 10: 30,689,756 Y632H probably damaging Het
Olfr142 T C 2: 90,252,625 Y121C probably damaging Het
Olfr273 A T 4: 52,855,636 N292K probably damaging Het
Olfr472 C A 7: 107,902,747 A10E probably benign Het
Olfr710 A T 7: 106,944,312 S230T probably benign Het
Olfr952 A T 9: 39,426,605 S155R possibly damaging Het
Pik3c2g A T 6: 139,622,387 Y167F probably damaging Het
Pik3cg A C 12: 32,194,709 C915W probably damaging Het
Ppfibp2 A G 7: 107,729,189 T476A probably benign Het
Rapgef1 C T 2: 29,719,689 H675Y possibly damaging Het
Rpn2 T A 2: 157,299,557 V263D probably damaging Het
Rps13 A G 7: 116,333,925 L16P probably damaging Het
Rsph14 C G 10: 74,957,587 Q360H possibly damaging Het
Rsph14 T G 10: 74,957,588 Q360P possibly damaging Het
Smarcc2 G A 10: 128,482,943 probably null Het
Sp8 G T 12: 118,849,015 V202L possibly damaging Het
Spag9 G A 11: 94,099,026 probably null Het
Svil A G 18: 5,090,855 N915S probably damaging Het
Syt17 A G 7: 118,433,957 L215P probably damaging Het
Tle6 G T 10: 81,596,153 P86T probably benign Het
Tph2 T C 10: 115,080,005 D421G probably benign Het
Trpm2 A C 10: 77,935,990 L605R probably benign Het
Vat1l T C 8: 114,236,800 probably null Het
Vdac3 T C 8: 22,580,509 N128D probably benign Het
Vegfb G A 19: 6,987,399 probably benign Het
Zfp808 T A 13: 62,171,903 N315K probably damaging Het
Other mutations in Dsg1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Dsg1b APN 18 20396476 missense probably damaging 1.00
IGL00675:Dsg1b APN 18 20391918 nonsense probably null
IGL01071:Dsg1b APN 18 20409215 missense probably damaging 1.00
IGL01589:Dsg1b APN 18 20409594 missense probably damaging 1.00
IGL01729:Dsg1b APN 18 20405238 missense possibly damaging 0.66
IGL01753:Dsg1b APN 18 20397849 splice site probably benign
IGL02560:Dsg1b APN 18 20409178 missense possibly damaging 0.80
IGL02654:Dsg1b APN 18 20409262 missense probably damaging 1.00
IGL02726:Dsg1b APN 18 20399485 missense probably benign
IGL03272:Dsg1b APN 18 20397389 missense probably benign 0.25
IGL03342:Dsg1b APN 18 20409460 missense probably benign 0.09
IGL02835:Dsg1b UTSW 18 20392014 missense possibly damaging 0.66
R0080:Dsg1b UTSW 18 20397367 missense probably damaging 1.00
R0133:Dsg1b UTSW 18 20404878 missense probably damaging 0.96
R0455:Dsg1b UTSW 18 20396025 missense probably benign 0.02
R0498:Dsg1b UTSW 18 20409333 missense possibly damaging 0.95
R0518:Dsg1b UTSW 18 20388164 missense probably benign 0.00
R1418:Dsg1b UTSW 18 20397430 nonsense probably null
R1429:Dsg1b UTSW 18 20390195 missense probably damaging 1.00
R1450:Dsg1b UTSW 18 20409184 missense probably damaging 1.00
R1569:Dsg1b UTSW 18 20396480 missense probably damaging 1.00
R1674:Dsg1b UTSW 18 20399521 missense probably benign
R1934:Dsg1b UTSW 18 20395906 missense probably damaging 1.00
R2004:Dsg1b UTSW 18 20396475 missense probably damaging 0.99
R2191:Dsg1b UTSW 18 20409618 makesense probably null
R2192:Dsg1b UTSW 18 20409618 makesense probably null
R2927:Dsg1b UTSW 18 20405251 missense probably benign 0.23
R3801:Dsg1b UTSW 18 20390203 missense probably damaging 1.00
R4205:Dsg1b UTSW 18 20408821 missense probably damaging 1.00
R4718:Dsg1b UTSW 18 20397929 missense probably damaging 0.98
R4853:Dsg1b UTSW 18 20408736 missense probably benign 0.01
R4853:Dsg1b UTSW 18 20390132 critical splice acceptor site probably null
R4981:Dsg1b UTSW 18 20408868 missense possibly damaging 0.66
R5125:Dsg1b UTSW 18 20397503 missense probably damaging 1.00
R5178:Dsg1b UTSW 18 20397503 missense probably damaging 1.00
R5213:Dsg1b UTSW 18 20395930 missense probably damaging 1.00
R5450:Dsg1b UTSW 18 20409064 missense probably damaging 1.00
R5605:Dsg1b UTSW 18 20399539 missense probably benign
R5778:Dsg1b UTSW 18 20409222 missense possibly damaging 0.66
R5808:Dsg1b UTSW 18 20408725 missense probably damaging 1.00
R6144:Dsg1b UTSW 18 20396419 missense possibly damaging 0.92
R6185:Dsg1b UTSW 18 20399486 missense probably benign
R6268:Dsg1b UTSW 18 20388163 missense probably benign 0.01
R6291:Dsg1b UTSW 18 20404791 missense possibly damaging 0.71
R6342:Dsg1b UTSW 18 20390243 missense probably damaging 1.00
R6449:Dsg1b UTSW 18 20394441 missense possibly damaging 0.82
R6566:Dsg1b UTSW 18 20397442 missense probably damaging 1.00
R6817:Dsg1b UTSW 18 20394405 missense probably damaging 1.00
R7235:Dsg1b UTSW 18 20399423 missense probably benign 0.01
R7857:Dsg1b UTSW 18 20396463 missense probably benign 0.06
R7940:Dsg1b UTSW 18 20396463 missense probably benign 0.06
R7990:Dsg1b UTSW 18 20405210 splice site probably null
Predicted Primers PCR Primer
(F):5'- GAACTTAGTGGCACTGGCTG -3'
(R):5'- AACAACTGGTTAGGCAATGCTTG -3'

Sequencing Primer
(F):5'- TGGTAATCGTGACCCAGTGAC -3'
(R):5'- ATGCTTGCAGACACGTACTG -3'
Posted On2015-03-25