Incidental Mutation 'R3778:Gls'
ID271873
Institutional Source Beutler Lab
Gene Symbol Gls
Ensembl Gene ENSMUSG00000026103
Gene Nameglutaminase
Synonyms
MMRRC Submission 040750-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3778 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location52163448-52233232 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 52168912 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 571 (V571A)
Ref Sequence ENSEMBL: ENSMUSP00000110158 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114512] [ENSMUST00000114513]
Predicted Effect probably benign
Transcript: ENSMUST00000114512
AA Change: V388A

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000110157
Gene: ENSMUSG00000026103
AA Change: V388A

DomainStartEndE-ValueType
Pfam:Glutaminase 66 352 1.7e-125 PFAM
ANK 407 437 3.9e-6 SMART
ANK 441 470 3.6e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114513
AA Change: V571A

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000110158
Gene: ENSMUSG00000026103
AA Change: V571A

DomainStartEndE-ValueType
low complexity region 56 77 N/A INTRINSIC
low complexity region 89 110 N/A INTRINSIC
Pfam:Glutaminase 249 535 4.2e-123 PFAM
ANK 590 620 6.02e-4 SMART
ANK 624 653 5.69e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126221
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136654
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138906
Predicted Effect unknown
Transcript: ENSMUST00000156887
AA Change: V101A
SMART Domains Protein: ENSMUSP00000116901
Gene: ENSMUSG00000026103
AA Change: V101A

DomainStartEndE-ValueType
Pfam:Glutaminase 5 66 3.1e-26 PFAM
ANK 121 151 6.02e-4 SMART
ANK 155 184 5.69e2 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the K-type mitochondrial glutaminase. The encoded protein is an phosphate-activated amidohydrolase that catalyzes the hydrolysis of glutamine to glutamate and ammonia. This protein is primarily expressed in the brain and kidney plays an essential role in generating energy for metabolism, synthesizing the brain neurotransmitter glutamate and maintaining acid-base balance in the kidney. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygotes for targeted null mutations die within 1 day postnatally with abnormal respiratory function and goal-oriented behavior toward dam. Mice homozygous for another allele exhibit abnormal TNFA-stimulated astrocyte extracellular vesicle release. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 A T 15: 64,746,997 L769H probably damaging Het
Aldh1a7 A T 19: 20,719,311 M106K possibly damaging Het
Ankfn1 G T 11: 89,441,394 P442Q probably damaging Het
Aox1 A C 1: 58,053,703 D158A possibly damaging Het
Apc A G 18: 34,313,081 N976S probably damaging Het
Cfap54 C T 10: 92,904,344 probably benign Het
Cldn1 C T 16: 26,371,466 C54Y probably damaging Het
Col22a1 A T 15: 71,973,692 I407N probably damaging Het
Cyp2e1 T C 7: 140,763,909 V20A possibly damaging Het
Erp27 A T 6: 136,919,903 N100K possibly damaging Het
Fam160a2 T A 7: 105,388,228 T383S probably damaging Het
Fbn1 C T 2: 125,317,086 C2253Y probably damaging Het
Flnb G A 14: 7,915,353 V1495I probably benign Het
Fscn3 A C 6: 28,430,032 K67T possibly damaging Het
Gm14569 T A X: 36,432,432 M875L probably benign Het
Gm4871 A G 5: 145,030,083 S197P probably damaging Het
Gm7104 A T 12: 88,285,671 noncoding transcript Het
Gp9 A T 6: 87,779,005 M1L probably benign Het
Greb1l T A 18: 10,469,444 L153H possibly damaging Het
H1foo T C 6: 115,949,747 probably null Het
Hadha A T 5: 30,120,129 C688S probably damaging Het
Hif1an A G 19: 44,569,408 D243G probably damaging Het
Hmcn1 A T 1: 150,802,824 D515E possibly damaging Het
Hsfy2 A T 1: 56,636,688 V230E possibly damaging Het
Ighv1-72 A T 12: 115,758,016 S107T probably damaging Het
Inpp4b T A 8: 82,041,992 V710D possibly damaging Het
Itpr3 A G 17: 27,095,472 D632G possibly damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Lrig2 A G 3: 104,457,961 I625T probably benign Het
Lrp2 A T 2: 69,509,204 M1121K probably benign Het
Man2b2 T C 5: 36,815,527 N548D probably benign Het
Mei1 T C 15: 82,082,008 L277P probably damaging Het
Mki67 A C 7: 135,696,130 S2392A probably benign Het
Mycbp2 T A 14: 103,197,285 I2241F probably damaging Het
Nalcn G A 14: 123,464,716 T461M probably damaging Het
Ncoa6 A G 2: 155,421,195 S440P probably damaging Het
Ncoa7 A G 10: 30,689,756 Y632H probably damaging Het
Notch2 T C 3: 98,146,623 S2201P probably damaging Het
Olfr472 C A 7: 107,902,747 A10E probably benign Het
Olfr95 T C 17: 37,211,758 T32A probably benign Het
Pard6g A T 18: 80,079,823 probably null Het
Pask T A 1: 93,327,467 I294F probably damaging Het
Pax9 A G 12: 56,696,748 Y60C probably damaging Het
Pcdh15 G A 10: 73,947,151 probably null Het
Pik3c2g A T 6: 139,622,387 Y167F probably damaging Het
Ppfibp2 A G 7: 107,729,189 T476A probably benign Het
Ppm1e T C 11: 87,248,928 probably null Het
Pqlc2 T C 4: 139,298,982 probably null Het
Rsph14 C G 10: 74,957,587 Q360H possibly damaging Het
Rsph14 T G 10: 74,957,588 Q360P possibly damaging Het
Sec24c A G 14: 20,683,307 Q234R possibly damaging Het
Shcbp1 A T 8: 4,736,295 N602K probably benign Het
Sirt5 A G 13: 43,383,107 probably null Het
Sp8 G T 12: 118,849,015 V202L possibly damaging Het
Tle6 G T 10: 81,596,153 P86T probably benign Het
Tmem235 A T 11: 117,862,300 H83L probably benign Het
Trappc10 A G 10: 78,200,802 V861A possibly damaging Het
Trpm2 A C 10: 77,935,990 L605R probably benign Het
Vat1l T C 8: 114,236,800 probably null Het
Wnt6 A C 1: 74,782,782 D174A possibly damaging Het
Wwox T C 8: 114,874,607 C355R probably benign Het
Zfp229 A T 17: 21,745,202 T138S probably benign Het
Other mutations in Gls
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01339:Gls APN 1 52188708 missense probably damaging 1.00
IGL01366:Gls APN 1 52168399 missense probably damaging 1.00
IGL01367:Gls APN 1 52168399 missense probably damaging 1.00
IGL01832:Gls APN 1 52168409 splice site probably null
IGL02045:Gls APN 1 52219515 missense probably benign 0.01
LCD18:Gls UTSW 1 52183367 intron probably benign
R0268:Gls UTSW 1 52232694 small deletion probably benign
R0373:Gls UTSW 1 52188699 missense probably damaging 1.00
R0590:Gls UTSW 1 52212375 unclassified probably benign
R1440:Gls UTSW 1 52191134 missense possibly damaging 0.59
R1628:Gls UTSW 1 52232676 missense probably benign 0.06
R3684:Gls UTSW 1 52166293 missense probably damaging 1.00
R3697:Gls UTSW 1 52199764 missense possibly damaging 0.65
R3824:Gls UTSW 1 52232988 missense possibly damaging 0.83
R4062:Gls UTSW 1 52196748 missense probably damaging 1.00
R4441:Gls UTSW 1 52196163 critical splice donor site probably null
R4740:Gls UTSW 1 52232788 missense probably damaging 0.99
R4816:Gls UTSW 1 52199945 intron probably benign
R5281:Gls UTSW 1 52191157 missense probably damaging 1.00
R5712:Gls UTSW 1 52196752 missense probably damaging 1.00
R6163:Gls UTSW 1 52215576 missense probably benign 0.00
R6357:Gls UTSW 1 52219506 missense probably damaging 0.99
R6498:Gls UTSW 1 52220039 missense probably benign
R7187:Gls UTSW 1 52219980 missense probably damaging 1.00
R7413:Gls UTSW 1 52215576 missense probably benign 0.00
R7545:Gls UTSW 1 52191152 missense probably damaging 1.00
R7627:Gls UTSW 1 52166266 missense probably benign 0.00
R7648:Gls UTSW 1 52196780 missense probably damaging 0.99
R7781:Gls UTSW 1 52212333 nonsense probably null
Z1176:Gls UTSW 1 52214488 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTTAGCTGTGCTACTGTGGAG -3'
(R):5'- TATCCGTCTTGGCTAAGGGC -3'

Sequencing Primer
(F):5'- GAGGAAGATAAACAGCTGTCTCTCC -3'
(R):5'- CTTGGCTAAGGGCGTGTG -3'
Posted On2015-03-25