Incidental Mutation 'R3778:Kcnd3'
ID271885
Institutional Source Beutler Lab
Gene Symbol Kcnd3
Ensembl Gene ENSMUSG00000040896
Gene Namepotassium voltage-gated channel, Shal-related family, member 3
SynonymsKv4.3, potassium channel Kv4.3M, potassium channel Kv4.3L
MMRRC Submission 040750-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3778 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location105452330-105674002 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 105658766 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 421 (A421V)
Ref Sequence ENSEMBL: ENSMUSP00000113436 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079169] [ENSMUST00000098761] [ENSMUST00000118360]
Predicted Effect probably damaging
Transcript: ENSMUST00000079169
AA Change: A421V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078169
Gene: ENSMUSG00000040896
AA Change: A421V

DomainStartEndE-ValueType
Pfam:Shal-type 3 31 3.2e-17 PFAM
BTB 40 139 1.76e-16 SMART
Pfam:Ion_trans 182 414 6.6e-45 PFAM
Pfam:Ion_trans_2 327 408 9.5e-15 PFAM
Pfam:DUF3399 442 563 4.7e-46 PFAM
low complexity region 610 625 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000098761
AA Change: A421V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096357
Gene: ENSMUSG00000040896
AA Change: A421V

DomainStartEndE-ValueType
Pfam:Shal-type 3 31 7.3e-19 PFAM
BTB 40 139 1.76e-16 SMART
transmembrane domain 180 202 N/A INTRINSIC
Pfam:Ion_trans 228 402 1e-31 PFAM
Pfam:Ion_trans_2 327 408 8.4e-15 PFAM
low complexity region 412 431 N/A INTRINSIC
Pfam:DUF3399 442 545 9.5e-52 PFAM
low complexity region 591 606 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118360
AA Change: A421V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113436
Gene: ENSMUSG00000040896
AA Change: A421V

DomainStartEndE-ValueType
Pfam:Shal-type 3 31 3.2e-17 PFAM
BTB 40 139 1.76e-16 SMART
Pfam:Ion_trans 182 414 6.6e-45 PFAM
Pfam:Ion_trans_2 327 408 9.5e-15 PFAM
Pfam:DUF3399 442 563 4.7e-46 PFAM
low complexity region 610 625 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141694
Meta Mutation Damage Score 0.1470 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shal-related subfamily, members of which form voltage-activated A-type potassium ion channels and are prominent in the repolarization phase of the action potential. This member includes two isoforms with different sizes, which are encoded by alternatively spliced transcript variants of this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a reporter (null) allele are viable and fertile and exhibit normal cardiac morphology and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 A T 15: 64,746,997 L769H probably damaging Het
Aldh1a7 A T 19: 20,719,311 M106K possibly damaging Het
Ankfn1 G T 11: 89,441,394 P442Q probably damaging Het
Aox1 A C 1: 58,053,703 D158A possibly damaging Het
Apc A G 18: 34,313,081 N976S probably damaging Het
Cfap54 C T 10: 92,904,344 probably benign Het
Cldn1 C T 16: 26,371,466 C54Y probably damaging Het
Col22a1 A T 15: 71,973,692 I407N probably damaging Het
Cyp2e1 T C 7: 140,763,909 V20A possibly damaging Het
Erp27 A T 6: 136,919,903 N100K possibly damaging Het
Fam160a2 T A 7: 105,388,228 T383S probably damaging Het
Fbn1 C T 2: 125,317,086 C2253Y probably damaging Het
Flnb G A 14: 7,915,353 V1495I probably benign Het
Fscn3 A C 6: 28,430,032 K67T possibly damaging Het
Gls A G 1: 52,168,912 V571A probably benign Het
Gm14569 T A X: 36,432,432 M875L probably benign Het
Gm4871 A G 5: 145,030,083 S197P probably damaging Het
Gm7104 A T 12: 88,285,671 noncoding transcript Het
Gp9 A T 6: 87,779,005 M1L probably benign Het
Greb1l T A 18: 10,469,444 L153H possibly damaging Het
H1foo T C 6: 115,949,747 probably null Het
Hadha A T 5: 30,120,129 C688S probably damaging Het
Hif1an A G 19: 44,569,408 D243G probably damaging Het
Hmcn1 A T 1: 150,802,824 D515E possibly damaging Het
Hsfy2 A T 1: 56,636,688 V230E possibly damaging Het
Ighv1-72 A T 12: 115,758,016 S107T probably damaging Het
Inpp4b T A 8: 82,041,992 V710D possibly damaging Het
Itpr3 A G 17: 27,095,472 D632G possibly damaging Het
Lrig2 A G 3: 104,457,961 I625T probably benign Het
Lrp2 A T 2: 69,509,204 M1121K probably benign Het
Man2b2 T C 5: 36,815,527 N548D probably benign Het
Mei1 T C 15: 82,082,008 L277P probably damaging Het
Mki67 A C 7: 135,696,130 S2392A probably benign Het
Mycbp2 T A 14: 103,197,285 I2241F probably damaging Het
Nalcn G A 14: 123,464,716 T461M probably damaging Het
Ncoa6 A G 2: 155,421,195 S440P probably damaging Het
Ncoa7 A G 10: 30,689,756 Y632H probably damaging Het
Notch2 T C 3: 98,146,623 S2201P probably damaging Het
Olfr472 C A 7: 107,902,747 A10E probably benign Het
Olfr95 T C 17: 37,211,758 T32A probably benign Het
Pard6g A T 18: 80,079,823 probably null Het
Pask T A 1: 93,327,467 I294F probably damaging Het
Pax9 A G 12: 56,696,748 Y60C probably damaging Het
Pcdh15 G A 10: 73,947,151 probably null Het
Pik3c2g A T 6: 139,622,387 Y167F probably damaging Het
Ppfibp2 A G 7: 107,729,189 T476A probably benign Het
Ppm1e T C 11: 87,248,928 probably null Het
Pqlc2 T C 4: 139,298,982 probably null Het
Rsph14 C G 10: 74,957,587 Q360H possibly damaging Het
Rsph14 T G 10: 74,957,588 Q360P possibly damaging Het
Sec24c A G 14: 20,683,307 Q234R possibly damaging Het
Shcbp1 A T 8: 4,736,295 N602K probably benign Het
Sirt5 A G 13: 43,383,107 probably null Het
Sp8 G T 12: 118,849,015 V202L possibly damaging Het
Tle6 G T 10: 81,596,153 P86T probably benign Het
Tmem235 A T 11: 117,862,300 H83L probably benign Het
Trappc10 A G 10: 78,200,802 V861A possibly damaging Het
Trpm2 A C 10: 77,935,990 L605R probably benign Het
Vat1l T C 8: 114,236,800 probably null Het
Wnt6 A C 1: 74,782,782 D174A possibly damaging Het
Wwox T C 8: 114,874,607 C355R probably benign Het
Zfp229 A T 17: 21,745,202 T138S probably benign Het
Other mutations in Kcnd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02296:Kcnd3 APN 3 105667001 nonsense probably null
PIT4498001:Kcnd3 UTSW 3 105658709 missense probably damaging 0.99
R0483:Kcnd3 UTSW 3 105459626 missense probably damaging 1.00
R0544:Kcnd3 UTSW 3 105658759 missense probably damaging 1.00
R1457:Kcnd3 UTSW 3 105668186 missense probably benign 0.00
R1853:Kcnd3 UTSW 3 105459752 missense probably damaging 1.00
R2030:Kcnd3 UTSW 3 105459537 missense probably damaging 1.00
R2077:Kcnd3 UTSW 3 105666999 missense probably benign 0.16
R2106:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R2287:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R2288:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R2316:Kcnd3 UTSW 3 105669126 missense probably benign 0.17
R2909:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R2924:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R2925:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3014:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3016:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3038:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3696:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3697:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3698:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3777:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3785:Kcnd3 UTSW 3 105668225 missense possibly damaging 0.79
R3810:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3811:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3815:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3816:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3819:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3877:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3879:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3899:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4300:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4367:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4370:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4491:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4549:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4550:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4569:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4571:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4593:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4594:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4595:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4624:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4625:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4627:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4630:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4631:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4632:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4799:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4822:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R5021:Kcnd3 UTSW 3 105658754 missense probably damaging 1.00
R5056:Kcnd3 UTSW 3 105666928 intron probably benign
R5849:Kcnd3 UTSW 3 105458795 utr 5 prime probably benign
R7198:Kcnd3 UTSW 3 105459540 missense probably damaging 1.00
R7224:Kcnd3 UTSW 3 105669084 missense probably damaging 0.98
R7532:Kcnd3 UTSW 3 105668210 missense probably damaging 1.00
R7578:Kcnd3 UTSW 3 105459617 missense probably benign 0.08
R8022:Kcnd3 UTSW 3 105458873 missense probably benign 0.19
Z1177:Kcnd3 UTSW 3 105459570 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GCTATGAAGCCCCACTTGTTTC -3'
(R):5'- GCTAACTGAGGACATTGGTGG -3'

Sequencing Primer
(F):5'- ACTTGTTTCCCACATGGCC -3'
(R):5'- GGTAGGAGGATACAACACCGCC -3'
Posted On2015-03-25