Incidental Mutation 'R3778:Man2b2'
ID271888
Institutional Source Beutler Lab
Gene Symbol Man2b2
Ensembl Gene ENSMUSG00000029119
Gene Namemannosidase 2, alpha B2
Synonyms135 kDa alpha-D-mannosidase
MMRRC Submission 040750-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3778 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location36806921-36830653 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36815527 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 548 (N548D)
Ref Sequence ENSEMBL: ENSMUSP00000031002 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031002]
Predicted Effect probably benign
Transcript: ENSMUST00000031002
AA Change: N548D

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000031002
Gene: ENSMUSG00000029119
AA Change: N548D

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Glyco_hydro_38 28 351 4e-100 PFAM
Alpha-mann_mid 356 439 3.3e-20 SMART
Pfam:Glyco_hydro_38C 487 1013 2e-98 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000124711
AA Change: N127D
SMART Domains Protein: ENSMUSP00000115495
Gene: ENSMUSG00000029119
AA Change: N127D

DomainStartEndE-ValueType
Pfam:Glyco_hydro_38C 67 469 2.5e-80 PFAM
low complexity region 483 493 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147893
SMART Domains Protein: ENSMUSP00000114319
Gene: ENSMUSG00000029119

DomainStartEndE-ValueType
Pfam:Glyco_hydro_38C 2 86 4.2e-8 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 A T 15: 64,746,997 L769H probably damaging Het
Aldh1a7 A T 19: 20,719,311 M106K possibly damaging Het
Ankfn1 G T 11: 89,441,394 P442Q probably damaging Het
Aox1 A C 1: 58,053,703 D158A possibly damaging Het
Apc A G 18: 34,313,081 N976S probably damaging Het
Cfap54 C T 10: 92,904,344 probably benign Het
Cldn1 C T 16: 26,371,466 C54Y probably damaging Het
Col22a1 A T 15: 71,973,692 I407N probably damaging Het
Cyp2e1 T C 7: 140,763,909 V20A possibly damaging Het
Erp27 A T 6: 136,919,903 N100K possibly damaging Het
Fam160a2 T A 7: 105,388,228 T383S probably damaging Het
Fbn1 C T 2: 125,317,086 C2253Y probably damaging Het
Flnb G A 14: 7,915,353 V1495I probably benign Het
Fscn3 A C 6: 28,430,032 K67T possibly damaging Het
Gls A G 1: 52,168,912 V571A probably benign Het
Gm14569 T A X: 36,432,432 M875L probably benign Het
Gm4871 A G 5: 145,030,083 S197P probably damaging Het
Gm7104 A T 12: 88,285,671 noncoding transcript Het
Gp9 A T 6: 87,779,005 M1L probably benign Het
Greb1l T A 18: 10,469,444 L153H possibly damaging Het
H1foo T C 6: 115,949,747 probably null Het
Hadha A T 5: 30,120,129 C688S probably damaging Het
Hif1an A G 19: 44,569,408 D243G probably damaging Het
Hmcn1 A T 1: 150,802,824 D515E possibly damaging Het
Hsfy2 A T 1: 56,636,688 V230E possibly damaging Het
Ighv1-72 A T 12: 115,758,016 S107T probably damaging Het
Inpp4b T A 8: 82,041,992 V710D possibly damaging Het
Itpr3 A G 17: 27,095,472 D632G possibly damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Lrig2 A G 3: 104,457,961 I625T probably benign Het
Lrp2 A T 2: 69,509,204 M1121K probably benign Het
Mei1 T C 15: 82,082,008 L277P probably damaging Het
Mki67 A C 7: 135,696,130 S2392A probably benign Het
Mycbp2 T A 14: 103,197,285 I2241F probably damaging Het
Nalcn G A 14: 123,464,716 T461M probably damaging Het
Ncoa6 A G 2: 155,421,195 S440P probably damaging Het
Ncoa7 A G 10: 30,689,756 Y632H probably damaging Het
Notch2 T C 3: 98,146,623 S2201P probably damaging Het
Olfr472 C A 7: 107,902,747 A10E probably benign Het
Olfr95 T C 17: 37,211,758 T32A probably benign Het
Pard6g A T 18: 80,079,823 probably null Het
Pask T A 1: 93,327,467 I294F probably damaging Het
Pax9 A G 12: 56,696,748 Y60C probably damaging Het
Pcdh15 G A 10: 73,947,151 probably null Het
Pik3c2g A T 6: 139,622,387 Y167F probably damaging Het
Ppfibp2 A G 7: 107,729,189 T476A probably benign Het
Ppm1e T C 11: 87,248,928 probably null Het
Pqlc2 T C 4: 139,298,982 probably null Het
Rsph14 C G 10: 74,957,587 Q360H possibly damaging Het
Rsph14 T G 10: 74,957,588 Q360P possibly damaging Het
Sec24c A G 14: 20,683,307 Q234R possibly damaging Het
Shcbp1 A T 8: 4,736,295 N602K probably benign Het
Sirt5 A G 13: 43,383,107 probably null Het
Sp8 G T 12: 118,849,015 V202L possibly damaging Het
Tle6 G T 10: 81,596,153 P86T probably benign Het
Tmem235 A T 11: 117,862,300 H83L probably benign Het
Trappc10 A G 10: 78,200,802 V861A possibly damaging Het
Trpm2 A C 10: 77,935,990 L605R probably benign Het
Vat1l T C 8: 114,236,800 probably null Het
Wnt6 A C 1: 74,782,782 D174A possibly damaging Het
Wwox T C 8: 114,874,607 C355R probably benign Het
Zfp229 A T 17: 21,745,202 T138S probably benign Het
Other mutations in Man2b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00970:Man2b2 APN 5 36816143 nonsense probably null
IGL01098:Man2b2 APN 5 36815556 missense probably damaging 1.00
IGL01367:Man2b2 APN 5 36814337 nonsense probably null
IGL01781:Man2b2 APN 5 36813745 missense possibly damaging 0.80
IGL01809:Man2b2 APN 5 36814516 missense probably benign 0.01
IGL02824:Man2b2 APN 5 36821851 missense probably benign 0.09
IGL03323:Man2b2 APN 5 36818514 missense probably benign 0.07
IGL03333:Man2b2 APN 5 36816139 missense probably damaging 0.96
R0505:Man2b2 UTSW 5 36816198 missense probably benign 0.00
R0715:Man2b2 UTSW 5 36826058 missense probably benign 0.00
R1435:Man2b2 UTSW 5 36813067 missense probably damaging 0.98
R1536:Man2b2 UTSW 5 36820927 missense probably benign 0.10
R1944:Man2b2 UTSW 5 36816180 missense probably benign
R2079:Man2b2 UTSW 5 36814372 missense possibly damaging 0.64
R2475:Man2b2 UTSW 5 36807875 missense probably benign 0.01
R2924:Man2b2 UTSW 5 36824102 missense probably benign 0.01
R2925:Man2b2 UTSW 5 36824102 missense probably benign 0.01
R2938:Man2b2 UTSW 5 36820986 missense probably benign 0.27
R3777:Man2b2 UTSW 5 36815527 missense probably benign 0.00
R3982:Man2b2 UTSW 5 36813820 missense probably benign 0.10
R4618:Man2b2 UTSW 5 36817639 missense probably benign 0.06
R4822:Man2b2 UTSW 5 36815521 missense probably damaging 1.00
R5320:Man2b2 UTSW 5 36810333 missense probably damaging 1.00
R5394:Man2b2 UTSW 5 36814518 missense probably benign 0.03
R5468:Man2b2 UTSW 5 36807175 missense probably benign 0.00
R5993:Man2b2 UTSW 5 36820980 missense probably benign 0.12
R6053:Man2b2 UTSW 5 36813038 missense probably benign 0.00
R6083:Man2b2 UTSW 5 36809041 missense probably damaging 1.00
R6376:Man2b2 UTSW 5 36821034 missense probably damaging 1.00
R6669:Man2b2 UTSW 5 36810358 missense probably benign 0.00
R7000:Man2b2 UTSW 5 36821869 missense probably damaging 1.00
R7108:Man2b2 UTSW 5 36815485 missense probably benign 0.04
R7376:Man2b2 UTSW 5 36813378 missense probably damaging 1.00
R7478:Man2b2 UTSW 5 36810313 missense probably damaging 1.00
R7712:Man2b2 UTSW 5 36810314 missense probably benign 0.00
R8059:Man2b2 UTSW 5 36816160 missense probably damaging 1.00
X0022:Man2b2 UTSW 5 36813892 missense probably damaging 0.99
Z1088:Man2b2 UTSW 5 36815356 missense possibly damaging 0.46
Z1177:Man2b2 UTSW 5 36813797 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGTGTCCTGGTCGAACAG -3'
(R):5'- CAAACCTGTAGCCTGTAAAGATGG -3'

Sequencing Primer
(F):5'- GCAGAATATAGCAGTCATTCATCACG -3'
(R):5'- CTGTAAAGATGGCATGGGAATCCTC -3'
Posted On2015-03-25