Incidental Mutation 'R3778:Cyp2e1'
ID271901
Institutional Source Beutler Lab
Gene Symbol Cyp2e1
Ensembl Gene ENSMUSG00000025479
Gene Namecytochrome P450, family 2, subfamily e, polypeptide 1
SynonymsCyp2e
MMRRC Submission 040750-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3778 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location140763739-140774987 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 140763909 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 20 (V20A)
Ref Sequence ENSEMBL: ENSMUSP00000147845 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026552] [ENSMUST00000209253] [ENSMUST00000210235]
Predicted Effect probably benign
Transcript: ENSMUST00000026552
AA Change: V20A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000026552
Gene: ENSMUSG00000025479
AA Change: V20A

DomainStartEndE-ValueType
transmembrane domain 2 23 N/A INTRINSIC
Pfam:p450 33 489 1.4e-147 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209253
AA Change: V20A

PolyPhen 2 Score 0.067 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect possibly damaging
Transcript: ENSMUST00000210235
AA Change: V20A

PolyPhen 2 Score 0.581 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210403
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and is induced by ethanol, the diabetic state, and starvation. The enzyme metabolizes both endogenous substrates, such as ethanol, acetone, and acetal, as well as exogenous substrates including benzene, carbon tetrachloride, ethylene glycol, and nitrosamines which are premutagens found in cigarette smoke. Due to its many substrates, this enzyme may be involved in such varied processes as gluconeogenesis, hepatic cirrhosis, diabetes, and cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit altered responses to xenobiotics including decreased urethane-induced tumors and allylnitrile- or acetamenophen-associated mortality but increased allylnitrile-induced vestibular function loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 A T 15: 64,746,997 L769H probably damaging Het
Aldh1a7 A T 19: 20,719,311 M106K possibly damaging Het
Ankfn1 G T 11: 89,441,394 P442Q probably damaging Het
Aox1 A C 1: 58,053,703 D158A possibly damaging Het
Apc A G 18: 34,313,081 N976S probably damaging Het
Cfap54 C T 10: 92,904,344 probably benign Het
Cldn1 C T 16: 26,371,466 C54Y probably damaging Het
Col22a1 A T 15: 71,973,692 I407N probably damaging Het
Erp27 A T 6: 136,919,903 N100K possibly damaging Het
Fam160a2 T A 7: 105,388,228 T383S probably damaging Het
Fbn1 C T 2: 125,317,086 C2253Y probably damaging Het
Flnb G A 14: 7,915,353 V1495I probably benign Het
Fscn3 A C 6: 28,430,032 K67T possibly damaging Het
Gls A G 1: 52,168,912 V571A probably benign Het
Gm14569 T A X: 36,432,432 M875L probably benign Het
Gm4871 A G 5: 145,030,083 S197P probably damaging Het
Gm7104 A T 12: 88,285,671 noncoding transcript Het
Gp9 A T 6: 87,779,005 M1L probably benign Het
Greb1l T A 18: 10,469,444 L153H possibly damaging Het
H1foo T C 6: 115,949,747 probably null Het
Hadha A T 5: 30,120,129 C688S probably damaging Het
Hif1an A G 19: 44,569,408 D243G probably damaging Het
Hmcn1 A T 1: 150,802,824 D515E possibly damaging Het
Hsfy2 A T 1: 56,636,688 V230E possibly damaging Het
Ighv1-72 A T 12: 115,758,016 S107T probably damaging Het
Inpp4b T A 8: 82,041,992 V710D possibly damaging Het
Itpr3 A G 17: 27,095,472 D632G possibly damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Lrig2 A G 3: 104,457,961 I625T probably benign Het
Lrp2 A T 2: 69,509,204 M1121K probably benign Het
Man2b2 T C 5: 36,815,527 N548D probably benign Het
Mei1 T C 15: 82,082,008 L277P probably damaging Het
Mki67 A C 7: 135,696,130 S2392A probably benign Het
Mycbp2 T A 14: 103,197,285 I2241F probably damaging Het
Nalcn G A 14: 123,464,716 T461M probably damaging Het
Ncoa6 A G 2: 155,421,195 S440P probably damaging Het
Ncoa7 A G 10: 30,689,756 Y632H probably damaging Het
Notch2 T C 3: 98,146,623 S2201P probably damaging Het
Olfr472 C A 7: 107,902,747 A10E probably benign Het
Olfr95 T C 17: 37,211,758 T32A probably benign Het
Pard6g A T 18: 80,079,823 probably null Het
Pask T A 1: 93,327,467 I294F probably damaging Het
Pax9 A G 12: 56,696,748 Y60C probably damaging Het
Pcdh15 G A 10: 73,947,151 probably null Het
Pik3c2g A T 6: 139,622,387 Y167F probably damaging Het
Ppfibp2 A G 7: 107,729,189 T476A probably benign Het
Ppm1e T C 11: 87,248,928 probably null Het
Pqlc2 T C 4: 139,298,982 probably null Het
Rsph14 C G 10: 74,957,587 Q360H possibly damaging Het
Rsph14 T G 10: 74,957,588 Q360P possibly damaging Het
Sec24c A G 14: 20,683,307 Q234R possibly damaging Het
Shcbp1 A T 8: 4,736,295 N602K probably benign Het
Sirt5 A G 13: 43,383,107 probably null Het
Sp8 G T 12: 118,849,015 V202L possibly damaging Het
Tle6 G T 10: 81,596,153 P86T probably benign Het
Tmem235 A T 11: 117,862,300 H83L probably benign Het
Trappc10 A G 10: 78,200,802 V861A possibly damaging Het
Trpm2 A C 10: 77,935,990 L605R probably benign Het
Vat1l T C 8: 114,236,800 probably null Het
Wnt6 A C 1: 74,782,782 D174A possibly damaging Het
Wwox T C 8: 114,874,607 C355R probably benign Het
Zfp229 A T 17: 21,745,202 T138S probably benign Het
Other mutations in Cyp2e1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00706:Cyp2e1 APN 7 140769153 missense probably benign 0.17
IGL01755:Cyp2e1 APN 7 140774556 critical splice acceptor site probably null
IGL01884:Cyp2e1 APN 7 140773750 missense probably benign 0.16
IGL01950:Cyp2e1 APN 7 140764961 critical splice donor site probably null
IGL01964:Cyp2e1 APN 7 140763866 missense probably damaging 1.00
IGL02430:Cyp2e1 APN 7 140770226 missense probably damaging 1.00
IGL02505:Cyp2e1 APN 7 140769156 missense probably damaging 1.00
IGL02596:Cyp2e1 APN 7 140770118 missense probably damaging 0.99
IGL02725:Cyp2e1 APN 7 140763915 missense probably null 1.00
IGL02887:Cyp2e1 APN 7 140763911 missense probably damaging 1.00
IGL03114:Cyp2e1 APN 7 140773129 missense possibly damaging 0.95
IGL03146:Cyp2e1 APN 7 140770221 missense probably benign 0.00
IGL03340:Cyp2e1 APN 7 140764854 missense probably damaging 1.00
R1396:Cyp2e1 UTSW 7 140773079 missense probably damaging 0.98
R2111:Cyp2e1 UTSW 7 140773634 missense probably damaging 1.00
R2230:Cyp2e1 UTSW 7 140764914 missense probably damaging 1.00
R2231:Cyp2e1 UTSW 7 140764914 missense probably damaging 1.00
R2383:Cyp2e1 UTSW 7 140770068 missense probably benign 0.06
R4082:Cyp2e1 UTSW 7 140771078 missense possibly damaging 0.67
R4707:Cyp2e1 UTSW 7 140763908 missense possibly damaging 0.58
R4751:Cyp2e1 UTSW 7 140774716 nonsense probably null
R4784:Cyp2e1 UTSW 7 140763908 missense possibly damaging 0.58
R4792:Cyp2e1 UTSW 7 140773675 missense probably benign
R4917:Cyp2e1 UTSW 7 140774614 missense possibly damaging 0.94
R4934:Cyp2e1 UTSW 7 140770117 missense probably damaging 1.00
R5092:Cyp2e1 UTSW 7 140774735 missense probably damaging 1.00
R5388:Cyp2e1 UTSW 7 140763993 missense probably damaging 1.00
R5423:Cyp2e1 UTSW 7 140770118 missense probably benign 0.01
R6740:Cyp2e1 UTSW 7 140763780 unclassified probably benign
R7065:Cyp2e1 UTSW 7 140763993 missense probably damaging 1.00
R7154:Cyp2e1 UTSW 7 140770137 missense probably damaging 1.00
R8054:Cyp2e1 UTSW 7 140770958 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- ACCAGCACTTTAGGCCAAG -3'
(R):5'- TCATTGGATAACAGCTGGCAC -3'

Sequencing Primer
(F):5'- CACTTTAGGCCAAGGGAGATG -3'
(R):5'- GCTGGCACTGAGTTTAATATATACAC -3'
Posted On2015-03-25