Incidental Mutation 'R3778:Inpp4b'
ID271903
Institutional Source Beutler Lab
Gene Symbol Inpp4b
Ensembl Gene ENSMUSG00000037940
Gene Nameinositol polyphosphate-4-phosphatase, type II
SynonymsE130107I17Rik
MMRRC Submission 040750-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.226) question?
Stock #R3778 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location81342556-82127914 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 82041992 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 710 (V710D)
Ref Sequence ENSEMBL: ENSMUSP00000150541 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042529] [ENSMUST00000109851] [ENSMUST00000109852] [ENSMUST00000169116] [ENSMUST00000169387] [ENSMUST00000170160] [ENSMUST00000172031] [ENSMUST00000213285] [ENSMUST00000215332] [ENSMUST00000217122]
Predicted Effect possibly damaging
Transcript: ENSMUST00000042529
AA Change: V693D

PolyPhen 2 Score 0.887 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000044466
Gene: ENSMUSG00000037940
AA Change: V693D

DomainStartEndE-ValueType
C2 40 147 1.72e0 SMART
low complexity region 302 319 N/A INTRINSIC
low complexity region 425 434 N/A INTRINSIC
transmembrane domain 898 920 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109851
AA Change: V578D

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105477
Gene: ENSMUSG00000037940
AA Change: V578D

DomainStartEndE-ValueType
low complexity region 22 35 N/A INTRINSIC
low complexity region 187 204 N/A INTRINSIC
low complexity region 310 319 N/A INTRINSIC
transmembrane domain 783 805 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109852
AA Change: V710D

PolyPhen 2 Score 0.887 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105478
Gene: ENSMUSG00000037940
AA Change: V710D

DomainStartEndE-ValueType
C2 40 164 5.29e0 SMART
low complexity region 319 336 N/A INTRINSIC
low complexity region 442 451 N/A INTRINSIC
transmembrane domain 915 937 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169116
AA Change: V710D

PolyPhen 2 Score 0.422 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000131947
Gene: ENSMUSG00000037940
AA Change: V710D

DomainStartEndE-ValueType
C2 40 164 5.29e0 SMART
low complexity region 319 336 N/A INTRINSIC
low complexity region 442 451 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169387
Predicted Effect possibly damaging
Transcript: ENSMUST00000170160
AA Change: V525D

PolyPhen 2 Score 0.755 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000132156
Gene: ENSMUSG00000037940
AA Change: V525D

DomainStartEndE-ValueType
low complexity region 134 151 N/A INTRINSIC
low complexity region 257 266 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000172031
AA Change: V710D

PolyPhen 2 Score 0.849 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000131324
Gene: ENSMUSG00000037940
AA Change: V710D

DomainStartEndE-ValueType
C2 40 164 5.29e0 SMART
low complexity region 319 336 N/A INTRINSIC
low complexity region 442 451 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000213285
AA Change: V710D

PolyPhen 2 Score 0.422 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000215332
AA Change: V710D

PolyPhen 2 Score 0.849 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000217122
AA Change: V710D

PolyPhen 2 Score 0.887 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INPP4B encodes the inositol polyphosphate 4-phosphatase type II, one of the enzymes involved in phosphatidylinositol signaling pathways. This enzyme removes the phosphate group at position 4 of the inositol ring from inositol 3,4-bisphosphate. There is limited data to suggest that the human type II enzyme is subject to alternative splicing, as has been established for the type I enzyme. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit osteoporosis, reduced long bone length, increased osteoclast numbers and size, increased osteoblast numbers, and increased bone resorption and resorption. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 A T 15: 64,746,997 L769H probably damaging Het
Aldh1a7 A T 19: 20,719,311 M106K possibly damaging Het
Ankfn1 G T 11: 89,441,394 P442Q probably damaging Het
Aox1 A C 1: 58,053,703 D158A possibly damaging Het
Apc A G 18: 34,313,081 N976S probably damaging Het
Cfap54 C T 10: 92,904,344 probably benign Het
Cldn1 C T 16: 26,371,466 C54Y probably damaging Het
Col22a1 A T 15: 71,973,692 I407N probably damaging Het
Cyp2e1 T C 7: 140,763,909 V20A possibly damaging Het
Erp27 A T 6: 136,919,903 N100K possibly damaging Het
Fam160a2 T A 7: 105,388,228 T383S probably damaging Het
Fbn1 C T 2: 125,317,086 C2253Y probably damaging Het
Flnb G A 14: 7,915,353 V1495I probably benign Het
Fscn3 A C 6: 28,430,032 K67T possibly damaging Het
Gls A G 1: 52,168,912 V571A probably benign Het
Gm14569 T A X: 36,432,432 M875L probably benign Het
Gm4871 A G 5: 145,030,083 S197P probably damaging Het
Gm7104 A T 12: 88,285,671 noncoding transcript Het
Gp9 A T 6: 87,779,005 M1L probably benign Het
Greb1l T A 18: 10,469,444 L153H possibly damaging Het
H1foo T C 6: 115,949,747 probably null Het
Hadha A T 5: 30,120,129 C688S probably damaging Het
Hif1an A G 19: 44,569,408 D243G probably damaging Het
Hmcn1 A T 1: 150,802,824 D515E possibly damaging Het
Hsfy2 A T 1: 56,636,688 V230E possibly damaging Het
Ighv1-72 A T 12: 115,758,016 S107T probably damaging Het
Itpr3 A G 17: 27,095,472 D632G possibly damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Lrig2 A G 3: 104,457,961 I625T probably benign Het
Lrp2 A T 2: 69,509,204 M1121K probably benign Het
Man2b2 T C 5: 36,815,527 N548D probably benign Het
Mei1 T C 15: 82,082,008 L277P probably damaging Het
Mki67 A C 7: 135,696,130 S2392A probably benign Het
Mycbp2 T A 14: 103,197,285 I2241F probably damaging Het
Nalcn G A 14: 123,464,716 T461M probably damaging Het
Ncoa6 A G 2: 155,421,195 S440P probably damaging Het
Ncoa7 A G 10: 30,689,756 Y632H probably damaging Het
Notch2 T C 3: 98,146,623 S2201P probably damaging Het
Olfr472 C A 7: 107,902,747 A10E probably benign Het
Olfr95 T C 17: 37,211,758 T32A probably benign Het
Pard6g A T 18: 80,079,823 probably null Het
Pask T A 1: 93,327,467 I294F probably damaging Het
Pax9 A G 12: 56,696,748 Y60C probably damaging Het
Pcdh15 G A 10: 73,947,151 probably null Het
Pik3c2g A T 6: 139,622,387 Y167F probably damaging Het
Ppfibp2 A G 7: 107,729,189 T476A probably benign Het
Ppm1e T C 11: 87,248,928 probably null Het
Pqlc2 T C 4: 139,298,982 probably null Het
Rsph14 C G 10: 74,957,587 Q360H possibly damaging Het
Rsph14 T G 10: 74,957,588 Q360P possibly damaging Het
Sec24c A G 14: 20,683,307 Q234R possibly damaging Het
Shcbp1 A T 8: 4,736,295 N602K probably benign Het
Sirt5 A G 13: 43,383,107 probably null Het
Sp8 G T 12: 118,849,015 V202L possibly damaging Het
Tle6 G T 10: 81,596,153 P86T probably benign Het
Tmem235 A T 11: 117,862,300 H83L probably benign Het
Trappc10 A G 10: 78,200,802 V861A possibly damaging Het
Trpm2 A C 10: 77,935,990 L605R probably benign Het
Vat1l T C 8: 114,236,800 probably null Het
Wnt6 A C 1: 74,782,782 D174A possibly damaging Het
Wwox T C 8: 114,874,607 C355R probably benign Het
Zfp229 A T 17: 21,745,202 T138S probably benign Het
Other mutations in Inpp4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Inpp4b APN 8 81856750 missense probably damaging 1.00
IGL01481:Inpp4b APN 8 81997380 missense probably damaging 1.00
IGL01509:Inpp4b APN 8 81890703 splice site probably benign
IGL01515:Inpp4b APN 8 81952711 missense possibly damaging 0.68
IGL01607:Inpp4b APN 8 82010663 missense probably benign 0.03
IGL01643:Inpp4b APN 8 82071771 missense probably damaging 0.97
IGL01736:Inpp4b APN 8 81997339 missense probably benign 0.00
IGL02154:Inpp4b APN 8 81969501 splice site probably benign
IGL02327:Inpp4b APN 8 82041962 missense probably benign 0.01
IGL02413:Inpp4b APN 8 82033171 missense probably benign
IGL02652:Inpp4b APN 8 81770800 splice site probably benign
IGL02678:Inpp4b APN 8 81856744 missense probably damaging 1.00
IGL03146:Inpp4b APN 8 81743781 missense possibly damaging 0.61
LCD18:Inpp4b UTSW 8 81693010 intron probably benign
PIT4280001:Inpp4b UTSW 8 82034417 missense probably benign 0.00
PIT4480001:Inpp4b UTSW 8 82046267 missense probably damaging 1.00
PIT4504001:Inpp4b UTSW 8 82041935 missense probably damaging 1.00
R0083:Inpp4b UTSW 8 81741462 missense possibly damaging 0.77
R0212:Inpp4b UTSW 8 81770917 missense probably benign 0.00
R0285:Inpp4b UTSW 8 82034516 splice site probably benign
R0363:Inpp4b UTSW 8 81884257 splice site probably benign
R0364:Inpp4b UTSW 8 81997314 missense probably benign 0.09
R0471:Inpp4b UTSW 8 82041899 missense possibly damaging 0.94
R0550:Inpp4b UTSW 8 81997337 missense probably benign 0.00
R0562:Inpp4b UTSW 8 81768151 missense possibly damaging 0.88
R0661:Inpp4b UTSW 8 81741462 missense possibly damaging 0.77
R0693:Inpp4b UTSW 8 81997314 missense probably benign 0.09
R1081:Inpp4b UTSW 8 82069024 missense probably damaging 0.97
R1251:Inpp4b UTSW 8 81890753 missense probably benign 0.01
R1374:Inpp4b UTSW 8 81743816 critical splice donor site probably null
R1445:Inpp4b UTSW 8 81952834 intron probably null
R1465:Inpp4b UTSW 8 81768157 missense probably damaging 1.00
R1465:Inpp4b UTSW 8 81768157 missense probably damaging 1.00
R1647:Inpp4b UTSW 8 81856774 splice site probably benign
R1754:Inpp4b UTSW 8 81770811 missense probably damaging 1.00
R1759:Inpp4b UTSW 8 81768103 missense probably benign 0.06
R2085:Inpp4b UTSW 8 81952274 missense probably damaging 1.00
R2156:Inpp4b UTSW 8 82048489 missense probably damaging 1.00
R2160:Inpp4b UTSW 8 82121375 nonsense probably null
R2175:Inpp4b UTSW 8 81856699 missense probably damaging 1.00
R2191:Inpp4b UTSW 8 81997302 missense probably damaging 1.00
R2401:Inpp4b UTSW 8 81997339 missense probably benign 0.00
R2475:Inpp4b UTSW 8 82041978 missense probably benign 0.09
R2512:Inpp4b UTSW 8 82010550 missense probably damaging 1.00
R2919:Inpp4b UTSW 8 81985329 missense possibly damaging 0.93
R3021:Inpp4b UTSW 8 81902838 missense possibly damaging 0.47
R3423:Inpp4b UTSW 8 81952261 missense possibly damaging 0.63
R3777:Inpp4b UTSW 8 82041992 missense possibly damaging 0.89
R3794:Inpp4b UTSW 8 82033216 missense probably damaging 1.00
R3795:Inpp4b UTSW 8 82033216 missense probably damaging 1.00
R4590:Inpp4b UTSW 8 81741411 start codon destroyed probably null 1.00
R4602:Inpp4b UTSW 8 81969535 missense probably damaging 0.99
R4691:Inpp4b UTSW 8 82122653 missense probably damaging 1.00
R4924:Inpp4b UTSW 8 82122624 missense probably damaging 1.00
R4992:Inpp4b UTSW 8 82033208 missense probably damaging 1.00
R5219:Inpp4b UTSW 8 81884156 missense probably benign 0.01
R5228:Inpp4b UTSW 8 81768115 missense probably damaging 0.99
R5557:Inpp4b UTSW 8 81952259 missense probably damaging 0.99
R5627:Inpp4b UTSW 8 81743816 critical splice donor site probably benign
R5691:Inpp4b UTSW 8 81890694 intron probably benign
R6186:Inpp4b UTSW 8 82046234 missense probably damaging 0.99
R6213:Inpp4b UTSW 8 81997390 missense probably damaging 1.00
R6232:Inpp4b UTSW 8 81952184 missense probably damaging 1.00
R6283:Inpp4b UTSW 8 81770833 missense probably damaging 1.00
R6302:Inpp4b UTSW 8 81768177 missense probably benign 0.00
R6309:Inpp4b UTSW 8 82041917 missense probably damaging 1.00
R6360:Inpp4b UTSW 8 81902852 missense probably benign 0.20
R6477:Inpp4b UTSW 8 81844714 unclassified probably null
R6773:Inpp4b UTSW 8 81856620 intron probably benign
R6968:Inpp4b UTSW 8 81844457 missense probably benign 0.18
R7147:Inpp4b UTSW 8 81902771 missense probably damaging 1.00
R7318:Inpp4b UTSW 8 82071745 missense probably damaging 1.00
R7409:Inpp4b UTSW 8 81952685 splice site probably null
R7455:Inpp4b UTSW 8 82071703 missense probably damaging 0.99
R7632:Inpp4b UTSW 8 82046339 missense probably damaging 1.00
R7844:Inpp4b UTSW 8 81741320 start gained probably benign
R7927:Inpp4b UTSW 8 81741320 start gained probably benign
RF003:Inpp4b UTSW 8 81969521 nonsense probably null
Z1088:Inpp4b UTSW 8 82068931 critical splice acceptor site probably null
Z1176:Inpp4b UTSW 8 82069001 missense possibly damaging 0.60
Predicted Primers PCR Primer
(F):5'- TCACTGAACTGCTAGGGACAATC -3'
(R):5'- AAGACCTCCTTATAGCATGCC -3'

Sequencing Primer
(F):5'- AATCCCAGCAGGGAGATA -3'
(R):5'- CCTTATAGCATGCCATCCAGG -3'
Posted On2015-03-25