Incidental Mutation 'R3778:Flnb'
ID271925
Institutional Source Beutler Lab
Gene Symbol Flnb
Ensembl Gene ENSMUSG00000025278
Gene Namefilamin, beta
Synonyms
MMRRC Submission 040750-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3778 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location7817957-7951588 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 7915353 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 1495 (V1495I)
Ref Sequence ENSEMBL: ENSMUSP00000052020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052678]
Predicted Effect probably benign
Transcript: ENSMUST00000052678
AA Change: V1495I

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000052020
Gene: ENSMUSG00000025278
AA Change: V1495I

DomainStartEndE-ValueType
CH 18 120 2.38e-26 SMART
CH 141 237 1.83e-18 SMART
IG_FLMN 253 350 1.17e-33 SMART
IG_FLMN 353 449 2.08e-34 SMART
IG_FLMN 451 546 3.42e-35 SMART
IG_FLMN 548 639 6.06e-27 SMART
IG_FLMN 644 739 1.94e-34 SMART
IG_FLMN 741 842 4.25e-31 SMART
IG_FLMN 844 941 5.16e-30 SMART
IG_FLMN 943 1037 5.12e-25 SMART
IG_FLMN 1039 1130 5.31e-41 SMART
IG_FLMN 1132 1225 1.4e-31 SMART
IG_FLMN 1227 1325 1.42e-32 SMART
IG_FLMN 1327 1418 5.19e-35 SMART
IG_FLMN 1420 1514 2.48e-41 SMART
IG_FLMN 1516 1611 3.15e-34 SMART
IG_FLMN 1613 1707 4.99e-37 SMART
IG_FLMN 1730 1819 4.44e-11 SMART
IG_FLMN 1820 1911 5.82e-38 SMART
IG_FLMN 1914 1997 5.68e-9 SMART
IG_FLMN 2001 2092 4.45e-34 SMART
IG_FLMN 2101 2188 1.24e-9 SMART
IG_FLMN 2192 2283 4.48e-39 SMART
IG_FLMN 2286 2378 2.94e-25 SMART
IG_FLMN 2383 2474 5.66e-27 SMART
IG_FLMN 2511 2602 1.63e-27 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the filamin family. The encoded protein interacts with glycoprotein Ib alpha as part of the process to repair vascular injuries. The platelet glycoprotein Ib complex includes glycoprotein Ib alpha, and it binds the actin cytoskeleton. Mutations in this gene have been found in several conditions: atelosteogenesis type 1 and type 3; boomerang dysplasia; autosomal dominant Larsen syndrome; and spondylocarpotarsal synostosis syndrome. Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mutations in this gene cause skeletal defects including runting, premature mineralization, and bone fusion. Nullizygous mice show a delay and reduction in long bone growth. Truncation mutations cause early fusion of spinal vertebrae due to enhanced chondrocyte hypertrophy and early differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 A T 15: 64,746,997 L769H probably damaging Het
Aldh1a7 A T 19: 20,719,311 M106K possibly damaging Het
Ankfn1 G T 11: 89,441,394 P442Q probably damaging Het
Aox1 A C 1: 58,053,703 D158A possibly damaging Het
Apc A G 18: 34,313,081 N976S probably damaging Het
Cfap54 C T 10: 92,904,344 probably benign Het
Cldn1 C T 16: 26,371,466 C54Y probably damaging Het
Col22a1 A T 15: 71,973,692 I407N probably damaging Het
Cyp2e1 T C 7: 140,763,909 V20A possibly damaging Het
Erp27 A T 6: 136,919,903 N100K possibly damaging Het
Fam160a2 T A 7: 105,388,228 T383S probably damaging Het
Fbn1 C T 2: 125,317,086 C2253Y probably damaging Het
Fscn3 A C 6: 28,430,032 K67T possibly damaging Het
Gls A G 1: 52,168,912 V571A probably benign Het
Gm14569 T A X: 36,432,432 M875L probably benign Het
Gm4871 A G 5: 145,030,083 S197P probably damaging Het
Gm7104 A T 12: 88,285,671 noncoding transcript Het
Gp9 A T 6: 87,779,005 M1L probably benign Het
Greb1l T A 18: 10,469,444 L153H possibly damaging Het
H1foo T C 6: 115,949,747 probably null Het
Hadha A T 5: 30,120,129 C688S probably damaging Het
Hif1an A G 19: 44,569,408 D243G probably damaging Het
Hmcn1 A T 1: 150,802,824 D515E possibly damaging Het
Hsfy2 A T 1: 56,636,688 V230E possibly damaging Het
Ighv1-72 A T 12: 115,758,016 S107T probably damaging Het
Inpp4b T A 8: 82,041,992 V710D possibly damaging Het
Itpr3 A G 17: 27,095,472 D632G possibly damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Lrig2 A G 3: 104,457,961 I625T probably benign Het
Lrp2 A T 2: 69,509,204 M1121K probably benign Het
Man2b2 T C 5: 36,815,527 N548D probably benign Het
Mei1 T C 15: 82,082,008 L277P probably damaging Het
Mki67 A C 7: 135,696,130 S2392A probably benign Het
Mycbp2 T A 14: 103,197,285 I2241F probably damaging Het
Nalcn G A 14: 123,464,716 T461M probably damaging Het
Ncoa6 A G 2: 155,421,195 S440P probably damaging Het
Ncoa7 A G 10: 30,689,756 Y632H probably damaging Het
Notch2 T C 3: 98,146,623 S2201P probably damaging Het
Olfr472 C A 7: 107,902,747 A10E probably benign Het
Olfr95 T C 17: 37,211,758 T32A probably benign Het
Pard6g A T 18: 80,079,823 probably null Het
Pask T A 1: 93,327,467 I294F probably damaging Het
Pax9 A G 12: 56,696,748 Y60C probably damaging Het
Pcdh15 G A 10: 73,947,151 probably null Het
Pik3c2g A T 6: 139,622,387 Y167F probably damaging Het
Ppfibp2 A G 7: 107,729,189 T476A probably benign Het
Ppm1e T C 11: 87,248,928 probably null Het
Pqlc2 T C 4: 139,298,982 probably null Het
Rsph14 C G 10: 74,957,587 Q360H possibly damaging Het
Rsph14 T G 10: 74,957,588 Q360P possibly damaging Het
Sec24c A G 14: 20,683,307 Q234R possibly damaging Het
Shcbp1 A T 8: 4,736,295 N602K probably benign Het
Sirt5 A G 13: 43,383,107 probably null Het
Sp8 G T 12: 118,849,015 V202L possibly damaging Het
Tle6 G T 10: 81,596,153 P86T probably benign Het
Tmem235 A T 11: 117,862,300 H83L probably benign Het
Trappc10 A G 10: 78,200,802 V861A possibly damaging Het
Trpm2 A C 10: 77,935,990 L605R probably benign Het
Vat1l T C 8: 114,236,800 probably null Het
Wnt6 A C 1: 74,782,782 D174A possibly damaging Het
Wwox T C 8: 114,874,607 C355R probably benign Het
Zfp229 A T 17: 21,745,202 T138S probably benign Het
Other mutations in Flnb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Flnb APN 14 7917390 splice site probably benign
IGL01063:Flnb APN 14 7926518 splice site probably benign
IGL01135:Flnb APN 14 7909736 missense probably benign
IGL01139:Flnb APN 14 7945989 missense probably damaging 1.00
IGL01364:Flnb APN 14 7934562 critical splice acceptor site probably null
IGL01417:Flnb APN 14 7905513 missense probably damaging 0.99
IGL01505:Flnb APN 14 7902003 critical splice donor site probably null
IGL01560:Flnb APN 14 7893829 missense probably benign 0.07
IGL01621:Flnb APN 14 7950470 missense probably damaging 1.00
IGL01656:Flnb APN 14 7902010 splice site probably benign
IGL01889:Flnb APN 14 7935967 missense possibly damaging 0.85
IGL01987:Flnb APN 14 7922748 critical splice donor site probably null
IGL02322:Flnb APN 14 7894676 missense probably damaging 1.00
IGL02496:Flnb APN 14 7930919 splice site probably benign
IGL02752:Flnb APN 14 7917338 missense probably benign
IGL03001:Flnb APN 14 7934680 missense probably damaging 0.99
IGL03076:Flnb APN 14 7901988 missense probably benign 0.01
IGL03085:Flnb APN 14 7882211 missense probably benign
IGL03170:Flnb APN 14 7818261 missense possibly damaging 0.90
IGL03373:Flnb APN 14 7890867 critical splice donor site probably null
Boomerang UTSW 14 7901945 missense probably damaging 1.00
Queensland UTSW 14 7927352 missense probably damaging 1.00
R3437_Flnb_252 UTSW 14 7942057 missense probably damaging 0.97
R8441_Flnb_221 UTSW 14 7896488 missense probably benign 0.15
Rhodelinda UTSW 14 7887682 splice site probably benign
saul UTSW 14 7889183 missense probably damaging 0.99
Xerxes UTSW 14 7867551 missense probably damaging 1.00
R0068:Flnb UTSW 14 7915290 missense possibly damaging 0.49
R0068:Flnb UTSW 14 7915290 missense possibly damaging 0.49
R0084:Flnb UTSW 14 7935979 missense probably benign
R0128:Flnb UTSW 14 7901951 missense probably damaging 0.99
R0130:Flnb UTSW 14 7901951 missense probably damaging 0.99
R0148:Flnb UTSW 14 7939077 missense probably benign 0.01
R0166:Flnb UTSW 14 7896115 missense probably damaging 1.00
R0376:Flnb UTSW 14 7946014 critical splice donor site probably null
R0547:Flnb UTSW 14 7912943 splice site probably null
R0612:Flnb UTSW 14 7887682 splice site probably benign
R0656:Flnb UTSW 14 7927352 missense probably damaging 1.00
R0691:Flnb UTSW 14 7890810 missense probably benign 0.16
R1241:Flnb UTSW 14 7896503 missense probably benign 0.06
R1572:Flnb UTSW 14 7883908 missense probably damaging 0.97
R1682:Flnb UTSW 14 7913121 missense probably benign 0.04
R1807:Flnb UTSW 14 7934645 missense probably benign 0.26
R1848:Flnb UTSW 14 7892113 missense probably damaging 1.00
R1959:Flnb UTSW 14 7884735 nonsense probably null
R2078:Flnb UTSW 14 7927466 missense probably damaging 1.00
R2132:Flnb UTSW 14 7873376 missense probably benign 0.04
R2209:Flnb UTSW 14 7905507 nonsense probably null
R2212:Flnb UTSW 14 7881652 small deletion probably benign
R2213:Flnb UTSW 14 7881652 small deletion probably benign
R2363:Flnb UTSW 14 7945950 missense possibly damaging 0.95
R2415:Flnb UTSW 14 7929932 missense probably benign 0.07
R2983:Flnb UTSW 14 7882250 missense probably damaging 1.00
R3001:Flnb UTSW 14 7907162 missense probably benign 0.22
R3002:Flnb UTSW 14 7907162 missense probably benign 0.22
R3436:Flnb UTSW 14 7942057 missense probably damaging 0.97
R3437:Flnb UTSW 14 7942057 missense probably damaging 0.97
R3783:Flnb UTSW 14 7889236 missense probably benign 0.04
R4162:Flnb UTSW 14 7915374 missense possibly damaging 0.81
R4163:Flnb UTSW 14 7915374 missense possibly damaging 0.81
R4164:Flnb UTSW 14 7915374 missense possibly damaging 0.81
R4356:Flnb UTSW 14 7922700 missense probably benign
R4369:Flnb UTSW 14 7942216 missense probably benign
R4783:Flnb UTSW 14 7905701 missense probably benign 0.12
R4785:Flnb UTSW 14 7905701 missense probably benign 0.12
R4790:Flnb UTSW 14 7905661 missense probably benign 0.34
R4828:Flnb UTSW 14 7919238 missense probably benign 0.13
R4882:Flnb UTSW 14 7929936 missense possibly damaging 0.56
R5002:Flnb UTSW 14 7945882 missense probably damaging 1.00
R5058:Flnb UTSW 14 7924262 nonsense probably null
R5184:Flnb UTSW 14 7901945 missense probably damaging 1.00
R5186:Flnb UTSW 14 7909748 missense probably damaging 1.00
R5395:Flnb UTSW 14 7883881 missense probably benign 0.02
R5421:Flnb UTSW 14 7926494 missense probably damaging 1.00
R5667:Flnb UTSW 14 7890843 missense probably benign 0.00
R5671:Flnb UTSW 14 7890843 missense probably benign 0.00
R5714:Flnb UTSW 14 7929073 missense probably damaging 1.00
R5860:Flnb UTSW 14 7931135 missense probably damaging 1.00
R5892:Flnb UTSW 14 7907183 missense probably damaging 1.00
R5924:Flnb UTSW 14 7890765 missense probably benign 0.00
R6131:Flnb UTSW 14 7894635 missense possibly damaging 0.79
R6244:Flnb UTSW 14 7892092 missense probably damaging 1.00
R6489:Flnb UTSW 14 7867551 missense probably damaging 1.00
R6582:Flnb UTSW 14 7892275 critical splice donor site probably null
R6586:Flnb UTSW 14 7929138 missense possibly damaging 0.93
R6611:Flnb UTSW 14 7915318 missense probably damaging 1.00
R6626:Flnb UTSW 14 7929012 missense probably damaging 1.00
R6700:Flnb UTSW 14 7892189 missense probably damaging 0.99
R6738:Flnb UTSW 14 7904536 missense probably benign 0.01
R6864:Flnb UTSW 14 7905640 missense possibly damaging 0.84
R6916:Flnb UTSW 14 7907171 missense probably damaging 0.99
R7117:Flnb UTSW 14 7894214 missense probably benign 0.02
R7164:Flnb UTSW 14 7915944 splice site probably null
R7328:Flnb UTSW 14 7883788 missense possibly damaging 0.95
R7328:Flnb UTSW 14 7894660 nonsense probably null
R7687:Flnb UTSW 14 7924224 missense probably damaging 1.00
R7716:Flnb UTSW 14 7917274 missense possibly damaging 0.64
R7763:Flnb UTSW 14 7926478 missense probably benign 0.00
R7821:Flnb UTSW 14 7939113 missense probably benign 0.00
R7921:Flnb UTSW 14 7933800 missense possibly damaging 0.57
R8008:Flnb UTSW 14 7892155 missense probably damaging 1.00
R8075:Flnb UTSW 14 7913048 missense probably benign 0.00
R8084:Flnb UTSW 14 7907243 missense probably benign 0.00
R8259:Flnb UTSW 14 7889183 missense probably damaging 0.99
R8441:Flnb UTSW 14 7896488 missense probably benign 0.15
R8493:Flnb UTSW 14 7869822 missense probably damaging 0.97
R8508:Flnb UTSW 14 7950394 missense probably damaging 0.98
R8531:Flnb UTSW 14 7929939 missense probably damaging 1.00
R8812:Flnb UTSW 14 7887624 missense probably benign 0.06
R8814:Flnb UTSW 14 7927409 missense probably damaging 1.00
R8825:Flnb UTSW 14 7887566 missense probably damaging 1.00
R8868:Flnb UTSW 14 7908671 missense probably benign 0.02
R8955:Flnb UTSW 14 7892874 missense probably damaging 1.00
R8955:Flnb UTSW 14 7904688 nonsense probably null
X0066:Flnb UTSW 14 7908636 missense probably damaging 1.00
Z1088:Flnb UTSW 14 7905871 missense probably benign 0.04
Z1176:Flnb UTSW 14 7942066 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- CATGGGAATGGACGTGATTCTC -3'
(R):5'- GGTTGACCCTAGAACAGAAGCC -3'

Sequencing Primer
(F):5'- ACGTGATTCTCTTTTATGTGTAGC -3'
(R):5'- TGGATGCCACCACAATGCTC -3'
Posted On2015-03-25