Incidental Mutation 'R3778:Mycbp2'
ID 271929
Institutional Source Beutler Lab
Gene Symbol Mycbp2
Ensembl Gene ENSMUSG00000033004
Gene Name MYC binding protein 2
Synonyms C130061D10Rik, Phr1, Pam
MMRRC Submission 040750-MU
Accession Numbers

Genbank: NM_207215; MGI: 2179432

Essential gene? Essential (E-score: 1.000) question?
Stock # R3778 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 103113411-103346814 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 103197285 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 2241 (I2241F)
Ref Sequence ENSEMBL: ENSMUSP00000124710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159855] [ENSMUST00000160758]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000159855
AA Change: I2241F

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124710
Gene: ENSMUSG00000033004
AA Change: I2241F

DomainStartEndE-ValueType
low complexity region 5 27 N/A INTRINSIC
low complexity region 47 55 N/A INTRINSIC
low complexity region 100 127 N/A INTRINSIC
low complexity region 178 191 N/A INTRINSIC
Pfam:RCC1_2 683 712 1.4e-10 PFAM
low complexity region 737 750 N/A INTRINSIC
low complexity region 793 815 N/A INTRINSIC
Pfam:RCC1_2 942 971 5.5e-10 PFAM
Pfam:RCC1 958 1006 4.8e-15 PFAM
Pfam:PHR 1235 1385 8.2e-44 PFAM
Pfam:PHR 1723 1880 1.4e-43 PFAM
low complexity region 1935 1948 N/A INTRINSIC
low complexity region 2182 2195 N/A INTRINSIC
Pfam:Filamin 2261 2431 7.5e-9 PFAM
Pfam:SH3_3 2472 2539 4.1e-9 PFAM
internal_repeat_3 2612 2679 1.69e-7 PROSPERO
low complexity region 2701 2710 N/A INTRINSIC
low complexity region 2884 2917 N/A INTRINSIC
low complexity region 2970 2984 N/A INTRINSIC
coiled coil region 3263 3290 N/A INTRINSIC
low complexity region 3352 3365 N/A INTRINSIC
low complexity region 3418 3433 N/A INTRINSIC
low complexity region 3678 3695 N/A INTRINSIC
APC10 3810 3968 1.11e-18 SMART
low complexity region 4103 4115 N/A INTRINSIC
low complexity region 4190 4212 N/A INTRINSIC
Blast:BBOX 4327 4370 7e-7 BLAST
RING 4496 4546 5.35e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000160758
AA Change: I2208F

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124601
Gene: ENSMUSG00000033004
AA Change: I2208F

DomainStartEndE-ValueType
low complexity region 14 22 N/A INTRINSIC
low complexity region 67 94 N/A INTRINSIC
low complexity region 145 158 N/A INTRINSIC
Pfam:RCC1_2 650 679 1e-10 PFAM
low complexity region 704 717 N/A INTRINSIC
low complexity region 760 782 N/A INTRINSIC
Pfam:RCC1_2 909 938 1.5e-9 PFAM
Pfam:RCC1 925 973 1.3e-15 PFAM
Pfam:PHR 1202 1353 1.6e-50 PFAM
Pfam:PHR 1690 1848 3.1e-58 PFAM
low complexity region 1902 1915 N/A INTRINSIC
low complexity region 2149 2162 N/A INTRINSIC
Pfam:Filamin 2228 2398 7.6e-9 PFAM
Pfam:SH3_3 2439 2507 2.3e-10 PFAM
internal_repeat_3 2554 2621 2e-7 PROSPERO
low complexity region 2643 2652 N/A INTRINSIC
low complexity region 2774 2807 N/A INTRINSIC
low complexity region 2860 2874 N/A INTRINSIC
coiled coil region 3153 3180 N/A INTRINSIC
low complexity region 3242 3255 N/A INTRINSIC
low complexity region 3308 3323 N/A INTRINSIC
low complexity region 3568 3585 N/A INTRINSIC
APC10 3700 3858 1.11e-18 SMART
low complexity region 3993 4005 N/A INTRINSIC
low complexity region 4080 4102 N/A INTRINSIC
Blast:BBOX 4217 4260 7e-7 BLAST
RING 4386 4436 5.35e-5 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted allele exhibit neonatal lethality, defective diaphragm innervation, abnormal brain morphology and defective axonal guidance. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(5) Chemically induced(3)

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 A T 15: 64,746,997 (GRCm38) L769H probably damaging Het
Aldh1a7 A T 19: 20,719,311 (GRCm38) M106K possibly damaging Het
Ankfn1 G T 11: 89,441,394 (GRCm38) P442Q probably damaging Het
Aox1 A C 1: 58,053,703 (GRCm38) D158A possibly damaging Het
Apc A G 18: 34,313,081 (GRCm38) N976S probably damaging Het
Cfap54 C T 10: 92,904,344 (GRCm38) probably benign Het
Cldn1 C T 16: 26,371,466 (GRCm38) C54Y probably damaging Het
Col22a1 A T 15: 71,973,692 (GRCm38) I407N probably damaging Het
Cyp2e1 T C 7: 140,763,909 (GRCm38) V20A possibly damaging Het
Erp27 A T 6: 136,919,903 (GRCm38) N100K possibly damaging Het
Fam160a2 T A 7: 105,388,228 (GRCm38) T383S probably damaging Het
Fbn1 C T 2: 125,317,086 (GRCm38) C2253Y probably damaging Het
Flnb G A 14: 7,915,353 (GRCm38) V1495I probably benign Het
Fscn3 A C 6: 28,430,032 (GRCm38) K67T possibly damaging Het
Gls A G 1: 52,168,912 (GRCm38) V571A probably benign Het
Gm14569 T A X: 36,432,432 (GRCm38) M875L probably benign Het
Gm4871 A G 5: 145,030,083 (GRCm38) S197P probably damaging Het
Gm7104 A T 12: 88,285,671 (GRCm38) noncoding transcript Het
Gp9 A T 6: 87,779,005 (GRCm38) M1L probably benign Het
Greb1l T A 18: 10,469,444 (GRCm38) L153H possibly damaging Het
H1foo T C 6: 115,949,747 (GRCm38) probably null Het
Hadha A T 5: 30,120,129 (GRCm38) C688S probably damaging Het
Hif1an A G 19: 44,569,408 (GRCm38) D243G probably damaging Het
Hmcn1 A T 1: 150,802,824 (GRCm38) D515E possibly damaging Het
Hsfy2 A T 1: 56,636,688 (GRCm38) V230E possibly damaging Het
Ighv1-72 A T 12: 115,758,016 (GRCm38) S107T probably damaging Het
Inpp4b T A 8: 82,041,992 (GRCm38) V710D possibly damaging Het
Itpr3 A G 17: 27,095,472 (GRCm38) D632G possibly damaging Het
Kcnd3 C T 3: 105,658,766 (GRCm38) A421V probably damaging Het
Lrig2 A G 3: 104,457,961 (GRCm38) I625T probably benign Het
Lrp2 A T 2: 69,509,204 (GRCm38) M1121K probably benign Het
Man2b2 T C 5: 36,815,527 (GRCm38) N548D probably benign Het
Mei1 T C 15: 82,082,008 (GRCm38) L277P probably damaging Het
Mki67 A C 7: 135,696,130 (GRCm38) S2392A probably benign Het
Nalcn G A 14: 123,464,716 (GRCm38) T461M probably damaging Het
Ncoa6 A G 2: 155,421,195 (GRCm38) S440P probably damaging Het
Ncoa7 A G 10: 30,689,756 (GRCm38) Y632H probably damaging Het
Notch2 T C 3: 98,146,623 (GRCm38) S2201P probably damaging Het
Olfr472 C A 7: 107,902,747 (GRCm38) A10E probably benign Het
Olfr95 T C 17: 37,211,758 (GRCm38) T32A probably benign Het
Pard6g A T 18: 80,079,823 (GRCm38) probably null Het
Pask T A 1: 93,327,467 (GRCm38) I294F probably damaging Het
Pax9 A G 12: 56,696,748 (GRCm38) Y60C probably damaging Het
Pcdh15 G A 10: 73,947,151 (GRCm38) probably null Het
Pik3c2g A T 6: 139,622,387 (GRCm38) Y167F probably damaging Het
Ppfibp2 A G 7: 107,729,189 (GRCm38) T476A probably benign Het
Ppm1e T C 11: 87,248,928 (GRCm38) probably null Het
Pqlc2 T C 4: 139,298,982 (GRCm38) probably null Het
Rsph14 T G 10: 74,957,588 (GRCm38) Q360P possibly damaging Het
Rsph14 C G 10: 74,957,587 (GRCm38) Q360H possibly damaging Het
Sec24c A G 14: 20,683,307 (GRCm38) Q234R possibly damaging Het
Shcbp1 A T 8: 4,736,295 (GRCm38) N602K probably benign Het
Sirt5 A G 13: 43,383,107 (GRCm38) probably null Het
Sp8 G T 12: 118,849,015 (GRCm38) V202L possibly damaging Het
Tle6 G T 10: 81,596,153 (GRCm38) P86T probably benign Het
Tmem235 A T 11: 117,862,300 (GRCm38) H83L probably benign Het
Trappc10 A G 10: 78,200,802 (GRCm38) V861A possibly damaging Het
Trpm2 A C 10: 77,935,990 (GRCm38) L605R probably benign Het
Vat1l T C 8: 114,236,800 (GRCm38) probably null Het
Wnt6 A C 1: 74,782,782 (GRCm38) D174A possibly damaging Het
Wwox T C 8: 114,874,607 (GRCm38) C355R probably benign Het
Zfp229 A T 17: 21,745,202 (GRCm38) T138S probably benign Het
Other mutations in Mycbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Mycbp2 APN 14 103,223,050 (GRCm38) missense probably damaging 1.00
IGL00518:Mycbp2 APN 14 103,155,808 (GRCm38) missense probably damaging 1.00
IGL00650:Mycbp2 APN 14 103,143,228 (GRCm38) missense probably damaging 0.97
IGL00653:Mycbp2 APN 14 103,143,228 (GRCm38) missense probably damaging 0.97
IGL00742:Mycbp2 APN 14 103,201,352 (GRCm38) missense probably damaging 1.00
IGL00755:Mycbp2 APN 14 103,194,621 (GRCm38) missense possibly damaging 0.72
IGL00793:Mycbp2 APN 14 103,126,753 (GRCm38) missense possibly damaging 0.77
IGL00916:Mycbp2 APN 14 103,291,283 (GRCm38) splice site probably benign
IGL00960:Mycbp2 APN 14 103,229,384 (GRCm38) missense possibly damaging 0.95
IGL00977:Mycbp2 APN 14 103,172,642 (GRCm38) missense probably damaging 0.98
IGL01349:Mycbp2 APN 14 103,122,547 (GRCm38) missense probably damaging 0.98
IGL01369:Mycbp2 APN 14 103,155,510 (GRCm38) missense possibly damaging 0.61
IGL01410:Mycbp2 APN 14 103,229,492 (GRCm38) splice site probably null
IGL01586:Mycbp2 APN 14 103,140,869 (GRCm38) critical splice donor site probably null
IGL01593:Mycbp2 APN 14 103,291,287 (GRCm38) critical splice donor site probably null
IGL01693:Mycbp2 APN 14 103,127,979 (GRCm38) missense probably damaging 0.99
IGL01730:Mycbp2 APN 14 103,135,204 (GRCm38) nonsense probably null
IGL01820:Mycbp2 APN 14 103,188,501 (GRCm38) missense probably damaging 1.00
IGL01974:Mycbp2 APN 14 103,143,211 (GRCm38) missense possibly damaging 0.88
IGL02071:Mycbp2 APN 14 103,154,907 (GRCm38) nonsense probably null
IGL02178:Mycbp2 APN 14 103,224,366 (GRCm38) missense probably benign 0.01
IGL02324:Mycbp2 APN 14 103,242,207 (GRCm38) missense probably damaging 1.00
IGL02442:Mycbp2 APN 14 103,314,375 (GRCm38) missense probably benign
IGL02607:Mycbp2 APN 14 103,285,273 (GRCm38) missense probably damaging 1.00
IGL02679:Mycbp2 APN 14 103,205,185 (GRCm38) missense probably benign
IGL02702:Mycbp2 APN 14 103,220,124 (GRCm38) missense probably benign 0.01
IGL02709:Mycbp2 APN 14 103,155,261 (GRCm38) missense probably damaging 0.97
IGL02736:Mycbp2 APN 14 103,114,242 (GRCm38) splice site probably benign
IGL02866:Mycbp2 APN 14 103,129,992 (GRCm38) missense probably damaging 0.98
IGL02939:Mycbp2 APN 14 103,177,279 (GRCm38) missense probably benign
IGL03082:Mycbp2 APN 14 103,204,369 (GRCm38) missense probably benign 0.23
IGL03142:Mycbp2 APN 14 103,298,776 (GRCm38) missense probably damaging 0.99
IGL03155:Mycbp2 APN 14 103,155,453 (GRCm38) missense probably benign 0.06
IGL03236:Mycbp2 APN 14 103,298,698 (GRCm38) missense probably damaging 0.99
IGL03256:Mycbp2 APN 14 103,188,589 (GRCm38) missense possibly damaging 0.92
IGL03303:Mycbp2 APN 14 103,247,758 (GRCm38) missense probably damaging 1.00
compost UTSW 14 103,156,453 (GRCm38) missense probably damaging 1.00
decompose UTSW 14 103,219,979 (GRCm38) missense probably benign 0.12
moulder UTSW 14 103,188,592 (GRCm38) missense probably damaging 1.00
N/A - 293:Mycbp2 UTSW 14 103,224,462 (GRCm38) splice site probably benign
R0040:Mycbp2 UTSW 14 103,224,272 (GRCm38) missense probably benign 0.11
R0040:Mycbp2 UTSW 14 103,224,272 (GRCm38) missense probably benign 0.11
R0057:Mycbp2 UTSW 14 103,152,142 (GRCm38) missense probably damaging 0.97
R0063:Mycbp2 UTSW 14 103,156,634 (GRCm38) unclassified probably benign
R0097:Mycbp2 UTSW 14 103,155,762 (GRCm38) missense probably damaging 1.00
R0097:Mycbp2 UTSW 14 103,155,762 (GRCm38) missense probably damaging 1.00
R0268:Mycbp2 UTSW 14 103,314,325 (GRCm38) nonsense probably null
R0388:Mycbp2 UTSW 14 103,156,667 (GRCm38) missense probably benign 0.01
R0410:Mycbp2 UTSW 14 103,135,133 (GRCm38) missense probably damaging 1.00
R0530:Mycbp2 UTSW 14 103,182,459 (GRCm38) missense probably damaging 1.00
R0591:Mycbp2 UTSW 14 103,196,391 (GRCm38) unclassified probably benign
R0671:Mycbp2 UTSW 14 103,194,588 (GRCm38) missense possibly damaging 0.95
R0755:Mycbp2 UTSW 14 103,174,794 (GRCm38) missense probably damaging 1.00
R0817:Mycbp2 UTSW 14 103,229,418 (GRCm38) missense probably damaging 0.99
R0818:Mycbp2 UTSW 14 103,229,418 (GRCm38) missense probably damaging 0.99
R0819:Mycbp2 UTSW 14 103,229,418 (GRCm38) missense probably damaging 0.99
R0881:Mycbp2 UTSW 14 103,220,013 (GRCm38) missense probably benign
R0903:Mycbp2 UTSW 14 103,275,857 (GRCm38) missense probably damaging 0.99
R0940:Mycbp2 UTSW 14 103,262,693 (GRCm38) unclassified probably benign
R0961:Mycbp2 UTSW 14 103,184,835 (GRCm38) missense probably damaging 1.00
R1004:Mycbp2 UTSW 14 103,140,917 (GRCm38) missense probably benign 0.00
R1138:Mycbp2 UTSW 14 103,174,826 (GRCm38) missense possibly damaging 0.84
R1170:Mycbp2 UTSW 14 103,200,152 (GRCm38) nonsense probably null
R1211:Mycbp2 UTSW 14 103,120,563 (GRCm38) missense probably benign 0.31
R1268:Mycbp2 UTSW 14 103,208,782 (GRCm38) missense probably damaging 1.00
R1298:Mycbp2 UTSW 14 103,155,898 (GRCm38) missense probably damaging 1.00
R1341:Mycbp2 UTSW 14 103,298,867 (GRCm38) splice site probably benign
R1469:Mycbp2 UTSW 14 103,188,520 (GRCm38) missense probably damaging 0.99
R1469:Mycbp2 UTSW 14 103,188,520 (GRCm38) missense probably damaging 0.99
R1513:Mycbp2 UTSW 14 103,204,389 (GRCm38) missense probably damaging 1.00
R1528:Mycbp2 UTSW 14 103,232,597 (GRCm38) missense possibly damaging 0.91
R1564:Mycbp2 UTSW 14 103,169,851 (GRCm38) splice site probably null
R1565:Mycbp2 UTSW 14 103,252,509 (GRCm38) missense possibly damaging 0.82
R1656:Mycbp2 UTSW 14 103,247,758 (GRCm38) missense probably damaging 1.00
R1694:Mycbp2 UTSW 14 103,227,511 (GRCm38) missense probably damaging 1.00
R1709:Mycbp2 UTSW 14 103,224,416 (GRCm38) missense probably damaging 1.00
R1728:Mycbp2 UTSW 14 103,155,178 (GRCm38) missense probably damaging 0.98
R1751:Mycbp2 UTSW 14 103,248,405 (GRCm38) missense probably damaging 0.98
R1767:Mycbp2 UTSW 14 103,248,405 (GRCm38) missense probably damaging 0.98
R1772:Mycbp2 UTSW 14 103,182,419 (GRCm38) missense probably damaging 1.00
R1784:Mycbp2 UTSW 14 103,155,178 (GRCm38) missense probably damaging 0.98
R1823:Mycbp2 UTSW 14 103,252,509 (GRCm38) missense possibly damaging 0.82
R1824:Mycbp2 UTSW 14 103,252,509 (GRCm38) missense possibly damaging 0.82
R1844:Mycbp2 UTSW 14 103,155,714 (GRCm38) missense possibly damaging 0.94
R1916:Mycbp2 UTSW 14 103,184,883 (GRCm38) missense probably damaging 1.00
R1944:Mycbp2 UTSW 14 103,229,404 (GRCm38) missense probably damaging 1.00
R1983:Mycbp2 UTSW 14 103,145,971 (GRCm38) missense probably damaging 0.97
R2002:Mycbp2 UTSW 14 103,248,403 (GRCm38) missense probably damaging 0.98
R2031:Mycbp2 UTSW 14 103,188,592 (GRCm38) missense probably damaging 1.00
R2035:Mycbp2 UTSW 14 103,260,239 (GRCm38) missense probably damaging 1.00
R2048:Mycbp2 UTSW 14 103,232,524 (GRCm38) critical splice donor site probably null
R2061:Mycbp2 UTSW 14 103,287,260 (GRCm38) missense probably damaging 0.99
R2113:Mycbp2 UTSW 14 103,220,076 (GRCm38) missense probably damaging 0.99
R2128:Mycbp2 UTSW 14 103,201,230 (GRCm38) missense probably benign 0.01
R2134:Mycbp2 UTSW 14 103,208,893 (GRCm38) missense probably damaging 1.00
R2135:Mycbp2 UTSW 14 103,208,893 (GRCm38) missense probably damaging 1.00
R2135:Mycbp2 UTSW 14 103,145,942 (GRCm38) missense probably benign
R2146:Mycbp2 UTSW 14 103,155,922 (GRCm38) missense probably damaging 0.97
R2147:Mycbp2 UTSW 14 103,155,922 (GRCm38) missense probably damaging 0.97
R2148:Mycbp2 UTSW 14 103,155,922 (GRCm38) missense probably damaging 0.97
R2150:Mycbp2 UTSW 14 103,155,922 (GRCm38) missense probably damaging 0.97
R2163:Mycbp2 UTSW 14 103,169,855 (GRCm38) critical splice donor site probably null
R2248:Mycbp2 UTSW 14 103,169,859 (GRCm38) missense possibly damaging 0.50
R2265:Mycbp2 UTSW 14 103,262,749 (GRCm38) missense probably benign 0.39
R2272:Mycbp2 UTSW 14 103,144,338 (GRCm38) missense probably null 0.66
R2379:Mycbp2 UTSW 14 103,174,950 (GRCm38) missense probably benign
R2495:Mycbp2 UTSW 14 103,200,118 (GRCm38) missense probably damaging 0.99
R2508:Mycbp2 UTSW 14 103,131,245 (GRCm38) missense probably damaging 0.99
R2510:Mycbp2 UTSW 14 103,155,255 (GRCm38) missense probably damaging 0.96
R2851:Mycbp2 UTSW 14 103,144,333 (GRCm38) missense probably damaging 0.99
R2852:Mycbp2 UTSW 14 103,144,333 (GRCm38) missense probably damaging 0.99
R2965:Mycbp2 UTSW 14 103,297,358 (GRCm38) missense probably benign 0.00
R3156:Mycbp2 UTSW 14 103,208,743 (GRCm38) splice site probably benign
R3404:Mycbp2 UTSW 14 103,200,114 (GRCm38) missense probably damaging 0.99
R3410:Mycbp2 UTSW 14 103,135,117 (GRCm38) missense probably damaging 1.00
R3429:Mycbp2 UTSW 14 103,229,430 (GRCm38) missense probably damaging 1.00
R3706:Mycbp2 UTSW 14 103,156,414 (GRCm38) missense probably benign 0.31
R3772:Mycbp2 UTSW 14 103,133,788 (GRCm38) missense possibly damaging 0.82
R3883:Mycbp2 UTSW 14 103,295,250 (GRCm38) missense probably damaging 0.97
R3884:Mycbp2 UTSW 14 103,295,250 (GRCm38) missense probably damaging 0.97
R3887:Mycbp2 UTSW 14 103,174,797 (GRCm38) missense probably damaging 0.98
R3923:Mycbp2 UTSW 14 103,126,713 (GRCm38) missense probably damaging 1.00
R3926:Mycbp2 UTSW 14 103,204,500 (GRCm38) missense probably damaging 1.00
R3959:Mycbp2 UTSW 14 103,295,252 (GRCm38) missense probably benign 0.00
R3966:Mycbp2 UTSW 14 103,138,725 (GRCm38) splice site probably benign
R4021:Mycbp2 UTSW 14 103,152,157 (GRCm38) missense probably damaging 0.97
R4363:Mycbp2 UTSW 14 103,248,457 (GRCm38) missense probably damaging 1.00
R4405:Mycbp2 UTSW 14 103,123,445 (GRCm38) missense probably damaging 1.00
R4407:Mycbp2 UTSW 14 103,287,228 (GRCm38) missense probably damaging 1.00
R4410:Mycbp2 UTSW 14 103,135,266 (GRCm38) missense probably damaging 1.00
R4434:Mycbp2 UTSW 14 103,133,789 (GRCm38) missense probably damaging 0.99
R4448:Mycbp2 UTSW 14 103,188,502 (GRCm38) missense possibly damaging 0.89
R4452:Mycbp2 UTSW 14 103,155,658 (GRCm38) missense probably damaging 0.99
R4573:Mycbp2 UTSW 14 103,346,297 (GRCm38) missense probably benign 0.05
R4589:Mycbp2 UTSW 14 103,177,313 (GRCm38) missense probably benign 0.04
R4621:Mycbp2 UTSW 14 103,219,979 (GRCm38) missense probably benign 0.12
R4622:Mycbp2 UTSW 14 103,219,979 (GRCm38) missense probably benign 0.12
R4729:Mycbp2 UTSW 14 103,188,591 (GRCm38) missense probably damaging 1.00
R4770:Mycbp2 UTSW 14 103,219,944 (GRCm38) missense probably benign 0.41
R4790:Mycbp2 UTSW 14 103,229,437 (GRCm38) missense probably damaging 1.00
R4884:Mycbp2 UTSW 14 103,211,295 (GRCm38) missense probably damaging 1.00
R4885:Mycbp2 UTSW 14 103,145,946 (GRCm38) missense possibly damaging 0.86
R4956:Mycbp2 UTSW 14 103,287,239 (GRCm38) missense probably damaging 0.99
R4980:Mycbp2 UTSW 14 103,260,385 (GRCm38) splice site probably null
R4994:Mycbp2 UTSW 14 103,169,994 (GRCm38) missense probably benign
R5029:Mycbp2 UTSW 14 103,156,510 (GRCm38) missense probably benign 0.21
R5038:Mycbp2 UTSW 14 103,296,939 (GRCm38) missense probably damaging 1.00
R5044:Mycbp2 UTSW 14 103,139,235 (GRCm38) critical splice donor site probably null
R5231:Mycbp2 UTSW 14 103,346,214 (GRCm38) critical splice donor site probably null
R5305:Mycbp2 UTSW 14 103,346,321 (GRCm38) missense probably benign 0.00
R5322:Mycbp2 UTSW 14 103,185,683 (GRCm38) critical splice acceptor site probably null
R5376:Mycbp2 UTSW 14 103,242,432 (GRCm38) nonsense probably null
R5414:Mycbp2 UTSW 14 103,306,261 (GRCm38) missense probably damaging 1.00
R5453:Mycbp2 UTSW 14 103,201,401 (GRCm38) missense probably damaging 0.99
R5462:Mycbp2 UTSW 14 103,200,126 (GRCm38) missense probably damaging 1.00
R5499:Mycbp2 UTSW 14 103,242,179 (GRCm38) missense probably damaging 1.00
R5502:Mycbp2 UTSW 14 103,173,814 (GRCm38) missense probably damaging 1.00
R5524:Mycbp2 UTSW 14 103,295,237 (GRCm38) missense probably damaging 1.00
R5533:Mycbp2 UTSW 14 103,282,645 (GRCm38) nonsense probably null
R5569:Mycbp2 UTSW 14 103,135,243 (GRCm38) missense probably damaging 1.00
R5574:Mycbp2 UTSW 14 103,142,767 (GRCm38) missense possibly damaging 0.94
R5579:Mycbp2 UTSW 14 103,291,333 (GRCm38) missense probably damaging 0.98
R5590:Mycbp2 UTSW 14 103,123,355 (GRCm38) missense probably damaging 1.00
R5592:Mycbp2 UTSW 14 103,194,677 (GRCm38) missense probably benign 0.02
R5643:Mycbp2 UTSW 14 103,287,334 (GRCm38) missense probably damaging 1.00
R5644:Mycbp2 UTSW 14 103,287,334 (GRCm38) missense probably damaging 1.00
R5645:Mycbp2 UTSW 14 103,188,615 (GRCm38) critical splice acceptor site probably null
R5645:Mycbp2 UTSW 14 103,188,608 (GRCm38) missense probably damaging 1.00
R5646:Mycbp2 UTSW 14 103,169,910 (GRCm38) missense probably benign 0.09
R5648:Mycbp2 UTSW 14 103,291,342 (GRCm38) missense probably damaging 1.00
R5651:Mycbp2 UTSW 14 103,282,665 (GRCm38) missense probably null 0.99
R5668:Mycbp2 UTSW 14 103,120,519 (GRCm38) missense possibly damaging 0.62
R5745:Mycbp2 UTSW 14 103,156,453 (GRCm38) missense possibly damaging 0.94
R5751:Mycbp2 UTSW 14 103,148,550 (GRCm38) missense probably damaging 0.99
R5756:Mycbp2 UTSW 14 103,133,974 (GRCm38) missense probably damaging 0.99
R5837:Mycbp2 UTSW 14 103,124,403 (GRCm38) missense probably damaging 1.00
R5984:Mycbp2 UTSW 14 103,126,684 (GRCm38) missense probably damaging 0.98
R6005:Mycbp2 UTSW 14 103,156,723 (GRCm38) missense probably benign
R6063:Mycbp2 UTSW 14 103,135,146 (GRCm38) missense probably damaging 1.00
R6091:Mycbp2 UTSW 14 103,223,046 (GRCm38) missense probably damaging 1.00
R6120:Mycbp2 UTSW 14 103,275,887 (GRCm38) missense probably benign 0.01
R6129:Mycbp2 UTSW 14 103,285,400 (GRCm38) missense probably benign 0.21
R6147:Mycbp2 UTSW 14 103,155,509 (GRCm38) nonsense probably null
R6161:Mycbp2 UTSW 14 103,298,747 (GRCm38) missense probably damaging 1.00
R6187:Mycbp2 UTSW 14 103,147,017 (GRCm38) missense probably damaging 1.00
R6208:Mycbp2 UTSW 14 103,295,228 (GRCm38) missense probably benign 0.11
R6228:Mycbp2 UTSW 14 103,260,229 (GRCm38) missense probably benign 0.24
R6301:Mycbp2 UTSW 14 103,155,426 (GRCm38) missense probably damaging 1.00
R6311:Mycbp2 UTSW 14 103,262,740 (GRCm38) missense possibly damaging 0.93
R6329:Mycbp2 UTSW 14 103,155,852 (GRCm38) missense probably benign 0.00
R6439:Mycbp2 UTSW 14 103,155,475 (GRCm38) missense probably benign 0.00
R6462:Mycbp2 UTSW 14 103,136,557 (GRCm38) critical splice donor site probably null
R6528:Mycbp2 UTSW 14 103,142,881 (GRCm38) missense probably damaging 0.99
R6736:Mycbp2 UTSW 14 103,191,567 (GRCm38) missense probably null 1.00
R6821:Mycbp2 UTSW 14 103,139,409 (GRCm38) missense probably damaging 1.00
R6851:Mycbp2 UTSW 14 103,260,194 (GRCm38) critical splice donor site probably null
R6948:Mycbp2 UTSW 14 103,285,267 (GRCm38) missense possibly damaging 0.94
R6977:Mycbp2 UTSW 14 103,154,906 (GRCm38) missense probably damaging 0.99
R6985:Mycbp2 UTSW 14 103,206,681 (GRCm38) missense possibly damaging 0.79
R7035:Mycbp2 UTSW 14 103,174,981 (GRCm38) missense probably benign
R7054:Mycbp2 UTSW 14 103,156,098 (GRCm38) missense possibly damaging 0.90
R7108:Mycbp2 UTSW 14 103,122,603 (GRCm38) missense probably damaging 1.00
R7117:Mycbp2 UTSW 14 103,154,077 (GRCm38) missense probably benign 0.21
R7137:Mycbp2 UTSW 14 103,282,679 (GRCm38) missense possibly damaging 0.94
R7169:Mycbp2 UTSW 14 103,260,200 (GRCm38) missense possibly damaging 0.78
R7218:Mycbp2 UTSW 14 103,133,846 (GRCm38) missense probably benign
R7234:Mycbp2 UTSW 14 103,215,337 (GRCm38) missense probably damaging 0.98
R7238:Mycbp2 UTSW 14 103,156,297 (GRCm38) missense probably damaging 1.00
R7244:Mycbp2 UTSW 14 103,208,909 (GRCm38) missense probably damaging 0.98
R7265:Mycbp2 UTSW 14 103,197,243 (GRCm38) critical splice donor site probably null
R7286:Mycbp2 UTSW 14 103,120,591 (GRCm38) missense probably damaging 1.00
R7332:Mycbp2 UTSW 14 103,197,357 (GRCm38) missense probably damaging 0.97
R7332:Mycbp2 UTSW 14 103,156,453 (GRCm38) missense probably damaging 1.00
R7384:Mycbp2 UTSW 14 103,276,393 (GRCm38) missense probably damaging 0.99
R7392:Mycbp2 UTSW 14 103,243,128 (GRCm38) missense probably damaging 0.99
R7392:Mycbp2 UTSW 14 103,152,191 (GRCm38) missense probably damaging 1.00
R7409:Mycbp2 UTSW 14 103,288,744 (GRCm38) missense probably damaging 1.00
R7486:Mycbp2 UTSW 14 103,197,254 (GRCm38) missense probably damaging 0.97
R7643:Mycbp2 UTSW 14 103,346,265 (GRCm38) missense probably benign
R7661:Mycbp2 UTSW 14 103,212,623 (GRCm38) missense probably damaging 1.00
R7663:Mycbp2 UTSW 14 103,191,609 (GRCm38) missense probably damaging 0.99
R7730:Mycbp2 UTSW 14 103,123,355 (GRCm38) missense probably damaging 0.99
R7757:Mycbp2 UTSW 14 103,191,619 (GRCm38) missense probably damaging 1.00
R7773:Mycbp2 UTSW 14 103,248,404 (GRCm38) missense probably damaging 0.97
R7787:Mycbp2 UTSW 14 103,127,097 (GRCm38) missense probably damaging 1.00
R7822:Mycbp2 UTSW 14 103,139,415 (GRCm38) missense probably benign 0.00
R7838:Mycbp2 UTSW 14 103,177,293 (GRCm38) missense probably benign 0.10
R7841:Mycbp2 UTSW 14 103,146,831 (GRCm38) critical splice donor site probably null
R7858:Mycbp2 UTSW 14 103,156,305 (GRCm38) missense probably damaging 1.00
R7873:Mycbp2 UTSW 14 103,156,146 (GRCm38) missense probably damaging 1.00
R7911:Mycbp2 UTSW 14 103,200,185 (GRCm38) missense probably damaging 0.99
R7942:Mycbp2 UTSW 14 103,155,238 (GRCm38) missense probably damaging 0.99
R7951:Mycbp2 UTSW 14 103,215,462 (GRCm38) missense probably damaging 0.99
R7958:Mycbp2 UTSW 14 103,129,964 (GRCm38) missense probably benign 0.00
R8235:Mycbp2 UTSW 14 103,198,674 (GRCm38) missense probably damaging 0.99
R8246:Mycbp2 UTSW 14 103,155,204 (GRCm38) missense probably damaging 0.99
R8338:Mycbp2 UTSW 14 103,135,265 (GRCm38) missense probably damaging 1.00
R8343:Mycbp2 UTSW 14 103,160,675 (GRCm38) splice site probably null
R8361:Mycbp2 UTSW 14 103,138,814 (GRCm38) missense probably damaging 1.00
R8490:Mycbp2 UTSW 14 103,208,831 (GRCm38) missense probably benign 0.00
R8524:Mycbp2 UTSW 14 103,155,459 (GRCm38) missense probably benign 0.23
R8525:Mycbp2 UTSW 14 103,212,719 (GRCm38) missense probably damaging 1.00
R8711:Mycbp2 UTSW 14 103,169,994 (GRCm38) missense probably benign 0.08
R8735:Mycbp2 UTSW 14 103,223,150 (GRCm38) missense probably damaging 0.99
R8825:Mycbp2 UTSW 14 103,229,435 (GRCm38) missense probably damaging 1.00
R8928:Mycbp2 UTSW 14 103,156,345 (GRCm38) missense probably benign
R8974:Mycbp2 UTSW 14 103,124,421 (GRCm38) missense probably damaging 1.00
R8987:Mycbp2 UTSW 14 103,208,796 (GRCm38) missense probably damaging 1.00
R9021:Mycbp2 UTSW 14 103,314,316 (GRCm38) missense probably benign 0.08
R9062:Mycbp2 UTSW 14 103,242,360 (GRCm38) missense probably benign 0.00
R9077:Mycbp2 UTSW 14 103,232,538 (GRCm38) missense probably damaging 1.00
R9208:Mycbp2 UTSW 14 103,295,228 (GRCm38) missense probably benign 0.01
R9285:Mycbp2 UTSW 14 103,197,317 (GRCm38) missense probably damaging 0.97
R9290:Mycbp2 UTSW 14 103,188,524 (GRCm38) missense probably damaging 0.99
R9362:Mycbp2 UTSW 14 103,260,206 (GRCm38) missense probably damaging 0.97
R9520:Mycbp2 UTSW 14 103,260,269 (GRCm38) missense probably benign 0.02
R9557:Mycbp2 UTSW 14 103,135,261 (GRCm38) missense probably benign 0.03
R9639:Mycbp2 UTSW 14 103,196,381 (GRCm38) missense probably damaging 1.00
R9666:Mycbp2 UTSW 14 103,134,038 (GRCm38) missense probably damaging 0.98
R9732:Mycbp2 UTSW 14 103,211,313 (GRCm38) missense probably damaging 1.00
R9736:Mycbp2 UTSW 14 103,197,416 (GRCm38) missense probably damaging 0.96
R9739:Mycbp2 UTSW 14 103,282,793 (GRCm38) missense probably benign 0.11
R9755:Mycbp2 UTSW 14 103,314,370 (GRCm38) missense probably benign
X0024:Mycbp2 UTSW 14 103,146,942 (GRCm38) missense probably damaging 1.00
Z1176:Mycbp2 UTSW 14 103,346,249 (GRCm38) missense probably benign
Z1176:Mycbp2 UTSW 14 103,156,637 (GRCm38) missense probably benign 0.06
Z1177:Mycbp2 UTSW 14 103,169,873 (GRCm38) missense possibly damaging 0.83
Z1177:Mycbp2 UTSW 14 103,135,123 (GRCm38) missense probably damaging 1.00
Z1177:Mycbp2 UTSW 14 103,127,063 (GRCm38) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CCTTTTGCTTTAGGTCCAAAACAC -3'
(R):5'- AATCATAAATGTAAGGCCATGGGTG -3'

Sequencing Primer
(F):5'- GCTTTAGGTCCAAAACACATAATCTG -3'
(R):5'- ACTGTGAGATGGAGCCTTTC -3'
Posted On 2015-03-25