Incidental Mutation 'R3778:Olfr95'
ID271937
Institutional Source Beutler Lab
Gene Symbol Olfr95
Ensembl Gene ENSMUSG00000049561
Gene Nameolfactory receptor 95
SynonymsMOR263-6, GA_x6K02T2PSCP-1651760-1650822
MMRRC Submission 040750-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R3778 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location37207950-37213118 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37211758 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 32 (T32A)
Ref Sequence ENSEMBL: ENSMUSP00000150480 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060728] [ENSMUST00000216318]
Predicted Effect probably benign
Transcript: ENSMUST00000060728
AA Change: T32A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000058929
Gene: ENSMUSG00000049561
AA Change: T32A

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 1.9e-57 PFAM
Pfam:7TM_GPCR_Srsx 34 259 1.7e-6 PFAM
Pfam:7tm_1 40 289 2.2e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216318
AA Change: T32A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 A T 15: 64,746,997 L769H probably damaging Het
Aldh1a7 A T 19: 20,719,311 M106K possibly damaging Het
Ankfn1 G T 11: 89,441,394 P442Q probably damaging Het
Aox1 A C 1: 58,053,703 D158A possibly damaging Het
Apc A G 18: 34,313,081 N976S probably damaging Het
Cfap54 C T 10: 92,904,344 probably benign Het
Cldn1 C T 16: 26,371,466 C54Y probably damaging Het
Col22a1 A T 15: 71,973,692 I407N probably damaging Het
Cyp2e1 T C 7: 140,763,909 V20A possibly damaging Het
Erp27 A T 6: 136,919,903 N100K possibly damaging Het
Fam160a2 T A 7: 105,388,228 T383S probably damaging Het
Fbn1 C T 2: 125,317,086 C2253Y probably damaging Het
Flnb G A 14: 7,915,353 V1495I probably benign Het
Fscn3 A C 6: 28,430,032 K67T possibly damaging Het
Gls A G 1: 52,168,912 V571A probably benign Het
Gm14569 T A X: 36,432,432 M875L probably benign Het
Gm4871 A G 5: 145,030,083 S197P probably damaging Het
Gm7104 A T 12: 88,285,671 noncoding transcript Het
Gp9 A T 6: 87,779,005 M1L probably benign Het
Greb1l T A 18: 10,469,444 L153H possibly damaging Het
H1foo T C 6: 115,949,747 probably null Het
Hadha A T 5: 30,120,129 C688S probably damaging Het
Hif1an A G 19: 44,569,408 D243G probably damaging Het
Hmcn1 A T 1: 150,802,824 D515E possibly damaging Het
Hsfy2 A T 1: 56,636,688 V230E possibly damaging Het
Ighv1-72 A T 12: 115,758,016 S107T probably damaging Het
Inpp4b T A 8: 82,041,992 V710D possibly damaging Het
Itpr3 A G 17: 27,095,472 D632G possibly damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Lrig2 A G 3: 104,457,961 I625T probably benign Het
Lrp2 A T 2: 69,509,204 M1121K probably benign Het
Man2b2 T C 5: 36,815,527 N548D probably benign Het
Mei1 T C 15: 82,082,008 L277P probably damaging Het
Mki67 A C 7: 135,696,130 S2392A probably benign Het
Mycbp2 T A 14: 103,197,285 I2241F probably damaging Het
Nalcn G A 14: 123,464,716 T461M probably damaging Het
Ncoa6 A G 2: 155,421,195 S440P probably damaging Het
Ncoa7 A G 10: 30,689,756 Y632H probably damaging Het
Notch2 T C 3: 98,146,623 S2201P probably damaging Het
Olfr472 C A 7: 107,902,747 A10E probably benign Het
Pard6g A T 18: 80,079,823 probably null Het
Pask T A 1: 93,327,467 I294F probably damaging Het
Pax9 A G 12: 56,696,748 Y60C probably damaging Het
Pcdh15 G A 10: 73,947,151 probably null Het
Pik3c2g A T 6: 139,622,387 Y167F probably damaging Het
Ppfibp2 A G 7: 107,729,189 T476A probably benign Het
Ppm1e T C 11: 87,248,928 probably null Het
Pqlc2 T C 4: 139,298,982 probably null Het
Rsph14 C G 10: 74,957,587 Q360H possibly damaging Het
Rsph14 T G 10: 74,957,588 Q360P possibly damaging Het
Sec24c A G 14: 20,683,307 Q234R possibly damaging Het
Shcbp1 A T 8: 4,736,295 N602K probably benign Het
Sirt5 A G 13: 43,383,107 probably null Het
Sp8 G T 12: 118,849,015 V202L possibly damaging Het
Tle6 G T 10: 81,596,153 P86T probably benign Het
Tmem235 A T 11: 117,862,300 H83L probably benign Het
Trappc10 A G 10: 78,200,802 V861A possibly damaging Het
Trpm2 A C 10: 77,935,990 L605R probably benign Het
Vat1l T C 8: 114,236,800 probably null Het
Wnt6 A C 1: 74,782,782 D174A possibly damaging Het
Wwox T C 8: 114,874,607 C355R probably benign Het
Zfp229 A T 17: 21,745,202 T138S probably benign Het
Other mutations in Olfr95
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02147:Olfr95 APN 17 37210986 missense probably damaging 1.00
IGL03306:Olfr95 APN 17 37211677 missense probably damaging 1.00
PIT4377001:Olfr95 UTSW 17 37211089 missense probably benign 0.00
R0668:Olfr95 UTSW 17 37211644 missense probably damaging 1.00
R0909:Olfr95 UTSW 17 37210918 missense probably benign 0.33
R1442:Olfr95 UTSW 17 37211704 missense probably benign 0.00
R1557:Olfr95 UTSW 17 37211353 missense probably damaging 1.00
R1758:Olfr95 UTSW 17 37211313 missense possibly damaging 0.88
R3195:Olfr95 UTSW 17 37211536 missense possibly damaging 0.87
R3749:Olfr95 UTSW 17 37211800 missense possibly damaging 0.55
R4458:Olfr95 UTSW 17 37211313 missense possibly damaging 0.88
R4591:Olfr95 UTSW 17 37211119 missense probably benign
R5058:Olfr95 UTSW 17 37211667 missense probably damaging 1.00
R5060:Olfr95 UTSW 17 37211416 missense probably benign 0.00
R5903:Olfr95 UTSW 17 37211021 nonsense probably null
R6294:Olfr95 UTSW 17 37211626 missense probably benign 0.19
R6689:Olfr95 UTSW 17 37211157 missense probably damaging 1.00
R7196:Olfr95 UTSW 17 37211193 missense probably damaging 1.00
R7677:Olfr95 UTSW 17 37211495 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAGAACATTTGCAGAGCGC -3'
(R):5'- TCAGTTCTAAGCCTTGATAGCC -3'

Sequencing Primer
(F):5'- CCAGAGCGCGAGATGTG -3'
(R):5'- CTTGACCAAAGGCTGAAG -3'
Posted On2015-03-25