Mutagenetix > Incidental Mutation

Incidental Mutation 'R3778:Greb1l'

271938

Institutional Source

Beutler Lab

Gene Symbol

Greb1l

Ensembl Gene

ENSMUSG00000042942

Gene Name

growth regulation by estrogen in breast cancer-like

Synonyms

AK220484, mKIAA4095

MMRRC Submission

040750-MU

Accession Numbers

Genbank: NM_001083628; MGI: 3576497

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R3778 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

10325177-10562934 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 10469444 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Histidine at position 153 (L153H)

Ref Sequence

ENSEMBL: ENSMUSP00000134090 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048977] [ENSMUST00000172532]

AlphaFold

B9EJV3

Predicted Effect

probably benign
Transcript: ENSMUST00000048977
AA Change: L153H

PolyPhen 2 Score 0.300 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000049003
Gene: ENSMUSG00000042942
AA Change: L153H

Domain	Start	End	E-Value	Type
Pfam:GREB1	1	1172	N/A	PFAM
Pfam:GREB1	1154	1913	N/A	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000172532
AA Change: L153H

PolyPhen 2 Score 0.600 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000134090
Gene: ENSMUSG00000042942
AA Change: L153H

Domain	Start	End	E-Value	Type
low complexity region	83	100	N/A	INTRINSIC
low complexity region	282	301	N/A	INTRINSIC
low complexity region	606	617	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173356

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.8%

Validation Efficiency

Allele List at MGI

All alleles(5) : Targeted, other(2) Gene trapped(3)

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy8	A	T	15: 64,746,997	L769H	probably damaging	Het
Aldh1a7	A	T	19: 20,719,311	M106K	possibly damaging	Het
Ankfn1	G	T	11: 89,441,394	P442Q	probably damaging	Het
Aox1	A	C	1: 58,053,703	D158A	possibly damaging	Het
Apc	A	G	18: 34,313,081	N976S	probably damaging	Het
Cfap54	C	T	10: 92,904,344		probably benign	Het
Cldn1	C	T	16: 26,371,466	C54Y	probably damaging	Het
Col22a1	A	T	15: 71,973,692	I407N	probably damaging	Het
Cyp2e1	T	C	7: 140,763,909	V20A	possibly damaging	Het
Erp27	A	T	6: 136,919,903	N100K	possibly damaging	Het
Fam160a2	T	A	7: 105,388,228	T383S	probably damaging	Het
Fbn1	C	T	2: 125,317,086	C2253Y	probably damaging	Het
Flnb	G	A	14: 7,915,353	V1495I	probably benign	Het
Fscn3	A	C	6: 28,430,032	K67T	possibly damaging	Het
Gls	A	G	1: 52,168,912	V571A	probably benign	Het
Gm14569	T	A	X: 36,432,432	M875L	probably benign	Het
Gm4871	A	G	5: 145,030,083	S197P	probably damaging	Het
Gm7104	A	T	12: 88,285,671		noncoding transcript	Het
Gp9	A	T	6: 87,779,005	M1L	probably benign	Het
H1foo	T	C	6: 115,949,747		probably null	Het
Hadha	A	T	5: 30,120,129	C688S	probably damaging	Het
Hif1an	A	G	19: 44,569,408	D243G	probably damaging	Het
Hmcn1	A	T	1: 150,802,824	D515E	possibly damaging	Het
Hsfy2	A	T	1: 56,636,688	V230E	possibly damaging	Het
Ighv1-72	A	T	12: 115,758,016	S107T	probably damaging	Het
Inpp4b	T	A	8: 82,041,992	V710D	possibly damaging	Het
Itpr3	A	G	17: 27,095,472	D632G	possibly damaging	Het
Kcnd3	C	T	3: 105,658,766	A421V	probably damaging	Het
Lrig2	A	G	3: 104,457,961	I625T	probably benign	Het
Lrp2	A	T	2: 69,509,204	M1121K	probably benign	Het
Man2b2	T	C	5: 36,815,527	N548D	probably benign	Het
Mei1	T	C	15: 82,082,008	L277P	probably damaging	Het
Mki67	A	C	7: 135,696,130	S2392A	probably benign	Het
Mycbp2	T	A	14: 103,197,285	I2241F	probably damaging	Het
Nalcn	G	A	14: 123,464,716	T461M	probably damaging	Het
Ncoa6	A	G	2: 155,421,195	S440P	probably damaging	Het
Ncoa7	A	G	10: 30,689,756	Y632H	probably damaging	Het
Notch2	T	C	3: 98,146,623	S2201P	probably damaging	Het
Olfr472	C	A	7: 107,902,747	A10E	probably benign	Het
Olfr95	T	C	17: 37,211,758	T32A	probably benign	Het
Pard6g	A	T	18: 80,079,823		probably null	Het
Pask	T	A	1: 93,327,467	I294F	probably damaging	Het
Pax9	A	G	12: 56,696,748	Y60C	probably damaging	Het
Pcdh15	G	A	10: 73,947,151		probably null	Het
Pik3c2g	A	T	6: 139,622,387	Y167F	probably damaging	Het
Ppfibp2	A	G	7: 107,729,189	T476A	probably benign	Het
Ppm1e	T	C	11: 87,248,928		probably null	Het
Pqlc2	T	C	4: 139,298,982		probably null	Het
Rsph14	C	G	10: 74,957,587	Q360H	possibly damaging	Het
Rsph14	T	G	10: 74,957,588	Q360P	possibly damaging	Het
Sec24c	A	G	14: 20,683,307	Q234R	possibly damaging	Het
Shcbp1	A	T	8: 4,736,295	N602K	probably benign	Het
Sirt5	A	G	13: 43,383,107		probably null	Het
Sp8	G	T	12: 118,849,015	V202L	possibly damaging	Het
Tle6	G	T	10: 81,596,153	P86T	probably benign	Het
Tmem235	A	T	11: 117,862,300	H83L	probably benign	Het
Trappc10	A	G	10: 78,200,802	V861A	possibly damaging	Het
Trpm2	A	C	10: 77,935,990	L605R	probably benign	Het
Vat1l	T	C	8: 114,236,800		probably null	Het
Wnt6	A	C	1: 74,782,782	D174A	possibly damaging	Het
Wwox	T	C	8: 114,874,607	C355R	probably benign	Het
Zfp229	A	T	17: 21,745,202	T138S	probably benign	Het

Other mutations in Greb1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00485:Greb1l	APN	18	10555962	missense	possibly damaging	0.90
IGL01554:Greb1l	APN	18	10522144	missense	probably benign	0.01
IGL01563:Greb1l	APN	18	10469399	missense	probably damaging	0.99
IGL01944:Greb1l	APN	18	10557280	missense	possibly damaging	0.91
IGL02110:Greb1l	APN	18	10515271	missense	probably damaging	1.00
IGL02249:Greb1l	APN	18	10532961	missense	probably damaging	1.00
IGL02318:Greb1l	APN	18	10469388	missense	possibly damaging	0.91
IGL02340:Greb1l	APN	18	10515200	missense	probably damaging	0.99
IGL02516:Greb1l	APN	18	10537064	missense	probably benign	0.31
IGL02566:Greb1l	APN	18	10503299	missense	probably damaging	0.99
IGL02583:Greb1l	APN	18	10542362	missense	probably damaging	1.00
IGL02838:Greb1l	APN	18	10560430	missense	probably damaging	1.00
A4554:Greb1l	UTSW	18	10532862	missense	possibly damaging	0.58
PIT4453001:Greb1l	UTSW	18	10533031	missense	probably damaging	0.98
PIT4453001:Greb1l	UTSW	18	10533032	missense	probably benign	0.08
R0099:Greb1l	UTSW	18	10509158	missense	probably damaging	1.00
R0226:Greb1l	UTSW	18	10522076	intron	probably benign
R0234:Greb1l	UTSW	18	10560331	missense	probably damaging	1.00
R0234:Greb1l	UTSW	18	10560331	missense	probably damaging	1.00
R0239:Greb1l	UTSW	18	10458567	splice site	probably benign
R0316:Greb1l	UTSW	18	10547420	missense	probably damaging	1.00
R0369:Greb1l	UTSW	18	10469375	missense	possibly damaging	0.80
R0394:Greb1l	UTSW	18	10523374	missense	probably damaging	0.99
R0478:Greb1l	UTSW	18	10509281	missense	probably damaging	1.00
R0555:Greb1l	UTSW	18	10458781	splice site	probably benign
R0671:Greb1l	UTSW	18	10474303	missense	probably damaging	1.00
R1282:Greb1l	UTSW	18	10547289	missense	probably benign	0.13
R1574:Greb1l	UTSW	18	10554997	missense	possibly damaging	0.95
R1574:Greb1l	UTSW	18	10554997	missense	possibly damaging	0.95
R1607:Greb1l	UTSW	18	10529703	missense	possibly damaging	0.85
R1666:Greb1l	UTSW	18	10501080	critical splice donor site	probably null
R1666:Greb1l	UTSW	18	10529708	critical splice donor site	probably null
R1720:Greb1l	UTSW	18	10553848	missense	probably benign	0.19
R1808:Greb1l	UTSW	18	10542143	missense	probably benign
R1829:Greb1l	UTSW	18	10509314	missense	probably damaging	1.00
R1897:Greb1l	UTSW	18	10498992	missense	probably benign	0.00
R1967:Greb1l	UTSW	18	10501049	missense	possibly damaging	0.91
R2025:Greb1l	UTSW	18	10515221	missense	possibly damaging	0.71
R2086:Greb1l	UTSW	18	10523281	missense	probably damaging	1.00
R2125:Greb1l	UTSW	18	10511422	missense	probably damaging	0.98
R2139:Greb1l	UTSW	18	10555011	missense	probably damaging	1.00
R2255:Greb1l	UTSW	18	10554857	missense	probably damaging	1.00
R2256:Greb1l	UTSW	18	10503307	missense	possibly damaging	0.91
R2257:Greb1l	UTSW	18	10503307	missense	possibly damaging	0.91
R2880:Greb1l	UTSW	18	10547288	missense	possibly damaging	0.93
R3623:Greb1l	UTSW	18	10542380	missense	probably damaging	0.99
R3975:Greb1l	UTSW	18	10522247	missense	possibly damaging	0.71
R4038:Greb1l	UTSW	18	10515209	missense	possibly damaging	0.93
R4062:Greb1l	UTSW	18	10522150	missense	probably damaging	0.99
R4134:Greb1l	UTSW	18	10529708	critical splice donor site	probably null
R4342:Greb1l	UTSW	18	10544561	missense	probably benign	0.12
R4409:Greb1l	UTSW	18	10503182	missense	possibly damaging	0.70
R4600:Greb1l	UTSW	18	10553705	missense	probably damaging	1.00
R4618:Greb1l	UTSW	18	10498965	missense	probably benign	0.00
R4683:Greb1l	UTSW	18	10529563	splice site	probably null
R4686:Greb1l	UTSW	18	10522112	missense	probably damaging	0.98
R4707:Greb1l	UTSW	18	10532922	missense	probably benign	0.02
R4780:Greb1l	UTSW	18	10541792	missense	probably benign	0.00
R4819:Greb1l	UTSW	18	10458358	missense	probably damaging	1.00
R4925:Greb1l	UTSW	18	10547447	missense	possibly damaging	0.79
R4960:Greb1l	UTSW	18	10547306	missense	probably damaging	0.99
R5150:Greb1l	UTSW	18	10555950	frame shift	probably null
R5154:Greb1l	UTSW	18	10458312	missense	probably benign	0.02
R5269:Greb1l	UTSW	18	10511409	missense	probably benign
R5290:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5310:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5328:Greb1l	UTSW	18	10553720	missense	probably damaging	1.00
R5337:Greb1l	UTSW	18	10509143	missense	probably damaging	1.00
R5393:Greb1l	UTSW	18	10458312	missense	probably benign	0.02
R5402:Greb1l	UTSW	18	10537169	missense	probably benign	0.26
R5718:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5719:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5720:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5721:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5902:Greb1l	UTSW	18	10538302	missense	probably benign	0.00
R5993:Greb1l	UTSW	18	10544455	missense	probably benign	0.10
R6035:Greb1l	UTSW	18	10501025	missense	possibly damaging	0.91
R6035:Greb1l	UTSW	18	10501025	missense	possibly damaging	0.91
R6045:Greb1l	UTSW	18	10547068	missense	probably damaging	1.00
R6063:Greb1l	UTSW	18	10557340	missense	probably damaging	1.00
R6297:Greb1l	UTSW	18	10469494	missense	probably damaging	1.00
R6405:Greb1l	UTSW	18	10501076	missense	probably benign	0.30
R6552:Greb1l	UTSW	18	10541814	missense	probably benign	0.00
R6572:Greb1l	UTSW	18	10522131	missense	probably benign	0.07
R6575:Greb1l	UTSW	18	10547347	missense	possibly damaging	0.88
R6922:Greb1l	UTSW	18	10547482	missense	possibly damaging	0.88
R6957:Greb1l	UTSW	18	10558786	missense	probably benign	0.23
R6962:Greb1l	UTSW	18	10547327	missense	probably damaging	1.00
R7012:Greb1l	UTSW	18	10529707	critical splice donor site	probably null
R7179:Greb1l	UTSW	18	10544576	missense	probably benign	0.00
R7251:Greb1l	UTSW	18	10515319	missense	probably damaging	1.00
R7275:Greb1l	UTSW	18	10544561	missense	probably benign	0.12
R7301:Greb1l	UTSW	18	10544970	missense	probably damaging	1.00
R7307:Greb1l	UTSW	18	10538142	missense	probably damaging	0.99
R7455:Greb1l	UTSW	18	10554915	missense	probably damaging	1.00
R7832:Greb1l	UTSW	18	10542056	missense	probably benign	0.38
R7934:Greb1l	UTSW	18	10474371	nonsense	probably null
R8137:Greb1l	UTSW	18	10474357	missense	possibly damaging	0.77
R8138:Greb1l	UTSW	18	10533060	missense	probably benign	0.13
R8208:Greb1l	UTSW	18	10510703	missense	probably damaging	1.00
R8227:Greb1l	UTSW	18	10515371	missense	probably damaging	1.00
R8312:Greb1l	UTSW	18	10511587	intron	probably benign
R8331:Greb1l	UTSW	18	10458706	missense	possibly damaging	0.96
R8364:Greb1l	UTSW	18	10529687	missense	possibly damaging	0.85
R8389:Greb1l	UTSW	18	10529613	missense	probably benign	0.00
R8695:Greb1l	UTSW	18	10544450	missense	probably benign	0.01
R8795:Greb1l	UTSW	18	10553739	missense	probably damaging	0.98
R8836:Greb1l	UTSW	18	10509257	missense	probably benign	0.30
R8862:Greb1l	UTSW	18	10555042	missense	possibly damaging	0.90
R8872:Greb1l	UTSW	18	10529684	missense	probably benign	0.18
R8874:Greb1l	UTSW	18	10544896	missense	probably benign	0.01
R8886:Greb1l	UTSW	18	10553843	missense	probably benign	0.21
R8921:Greb1l	UTSW	18	10541825	missense	probably benign	0.01
R8997:Greb1l	UTSW	18	10510747	missense	probably damaging	1.00
R9015:Greb1l	UTSW	18	10541675	missense	probably benign	0.00
R9018:Greb1l	UTSW	18	10542004	missense	possibly damaging	0.76
R9074:Greb1l	UTSW	18	10532797	missense	probably damaging	1.00
R9074:Greb1l	UTSW	18	10558795	missense	probably damaging	1.00
R9117:Greb1l	UTSW	18	10542422	missense	probably benign	0.31
R9189:Greb1l	UTSW	18	10499983	missense	probably benign
R9332:Greb1l	UTSW	18	10532796	missense	possibly damaging	0.92
R9367:Greb1l	UTSW	18	10522130	missense	probably benign	0.00
R9497:Greb1l	UTSW	18	10458600	missense	probably benign	0.00
R9796:Greb1l	UTSW	18	10538233	missense	possibly damaging	0.69
Z1176:Greb1l	UTSW	18	10515305	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TATTCTCCCAACAGGTAGATAAGGAG -3'
(R):5'- GGATGAAATTGAGAGCATTACATGTGC -3'

Sequencing Primer
(F):5'- GTAGATAAGGAGAGATTACCTTCCC -3'
(R):5'- TCTTTTCCCAGGGCTGAGGAC -3'

Posted On

2015-03-25