Incidental Mutation 'R3779:Jak1'
ID271951
Institutional Source Beutler Lab
Gene Symbol Jak1
Ensembl Gene ENSMUSG00000028530
Gene NameJanus kinase 1
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3779 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location101152367-101265282 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 101156490 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 1014 (H1014Y)
Ref Sequence ENSEMBL: ENSMUSP00000099842 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038463] [ENSMUST00000102781]
Predicted Effect probably benign
Transcript: ENSMUST00000038463
SMART Domains Protein: ENSMUSP00000043142
Gene: ENSMUSG00000035275

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
RRM 59 125 8.2e-11 SMART
RRM 132 205 1.67e-11 SMART
RRM 221 294 2.12e-4 SMART
low complexity region 362 379 N/A INTRINSIC
low complexity region 499 512 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102781
AA Change: H1014Y

PolyPhen 2 Score 0.403 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000099842
Gene: ENSMUSG00000028530
AA Change: H1014Y

DomainStartEndE-ValueType
B41 32 286 2.45e-58 SMART
Blast:B41 291 420 4e-51 BLAST
SH2 437 531 1.85e-13 SMART
STYKc 582 844 6.72e-14 SMART
TyrKc 874 1148 9.01e-122 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151235
Meta Mutation Damage Score 0.0899 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane protein that is a member of a class of protein-tyrosine kinases (PTK) characterized by the presence of a second phosphotransferase-related domain immediately N-terminal to the PTK domain. The encoded kinase phosphorylates STAT proteins (signal transducers and activators of transcription) and plays a key role in interferon-alpha/beta and interferon-gamma signal transduction. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for disruption of this gene die within the first 24 hours after birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310079G19Rik A G 16: 88,627,385 C73R probably damaging Het
Acot10 A G 15: 20,665,542 V371A probably damaging Het
Ambn C A 5: 88,465,342 probably benign Het
Ankrd34a T C 3: 96,598,931 F484L possibly damaging Het
Bcl11a A G 11: 24,164,568 K637R probably damaging Het
Cenpe T C 3: 135,256,576 S1968P possibly damaging Het
Cfap61 T C 2: 145,950,794 I52T probably damaging Het
Cit A T 5: 115,859,341 M128L probably benign Het
Cnga1 G T 5: 72,604,783 L463I probably damaging Het
Dnah11 C T 12: 118,130,713 probably benign Het
Elovl4 ACT A 9: 83,785,148 probably null Het
Ep400 A G 5: 110,691,649 I1853T unknown Het
Flg2 C T 3: 93,202,423 S586L unknown Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably benign Het
Gm21886 G T 18: 80,089,434 Q170K possibly damaging Het
Gm5819 A G 18: 8,694,429 E118G probably damaging Het
Gm9376 T C 14: 118,267,315 V53A probably benign Het
H2-T3 T C 17: 36,189,682 T90A probably damaging Het
Hif1an A G 19: 44,569,408 D243G probably damaging Het
Hmgcs2 C T 3: 98,299,112 probably benign Het
Ighv1-72 A T 12: 115,758,016 S107T probably damaging Het
Klrb1c T C 6: 128,780,343 D253G probably damaging Het
Lpin1 G A 12: 16,564,568 T404M probably damaging Het
Map3k9 A T 12: 81,743,791 probably benign Het
Myl12a G T 17: 70,994,636 H165Q possibly damaging Het
Olfr768 A G 10: 129,093,296 F226S possibly damaging Het
Pdgfrb T A 18: 61,072,666 S575T probably damaging Het
Phldb2 T C 16: 45,748,755 Y1247C probably damaging Het
Pinlyp T A 7: 24,541,835 T181S probably benign Het
Pkn2 A G 3: 142,793,980 V928A possibly damaging Het
Skint5 C T 4: 113,779,040 probably benign Het
Skiv2l2 A T 13: 112,903,392 probably benign Het
Slc24a1 A G 9: 64,948,297 Y443H unknown Het
Sp8 G T 12: 118,849,015 V202L possibly damaging Het
Svil A G 18: 5,090,855 N915S probably damaging Het
Syncrip A C 9: 88,476,939 D172E probably damaging Het
Tex26 T C 5: 149,445,851 I48T probably damaging Het
Trpm6 A C 19: 18,876,039 I1808L possibly damaging Het
Uba2 T C 7: 34,154,646 probably null Het
Vwa8 T A 14: 79,102,322 probably benign Het
Wfs1 C A 5: 36,968,624 V308L probably benign Het
Wrn T A 8: 33,241,020 R1095W probably damaging Het
Zfp808 T A 13: 62,171,903 N315K probably damaging Het
Other mutations in Jak1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00906:Jak1 APN 4 101154629 missense probably damaging 1.00
IGL00990:Jak1 APN 4 101171357 missense probably damaging 1.00
IGL01341:Jak1 APN 4 101175093 missense probably damaging 0.98
IGL02102:Jak1 APN 4 101159086 missense probably benign 0.11
IGL02720:Jak1 APN 4 101164450 splice site probably benign
IGL03301:Jak1 APN 4 101175173 missense probably damaging 1.00
Back UTSW 4 101174211 critical splice acceptor site probably null
Behind UTSW 4 101154537 critical splice donor site probably null
PIT4377001:Jak1 UTSW 4 101179551 missense probably benign 0.19
R0308:Jak1 UTSW 4 101154535 splice site probably null
R0544:Jak1 UTSW 4 101191625 missense probably benign
R1212:Jak1 UTSW 4 101189094 missense probably damaging 1.00
R1519:Jak1 UTSW 4 101162922 missense probably damaging 0.99
R1627:Jak1 UTSW 4 101191624 unclassified probably null
R1760:Jak1 UTSW 4 101162929 missense probably benign 0.04
R2116:Jak1 UTSW 4 101179675 missense probably damaging 0.98
R2980:Jak1 UTSW 4 101179781 missense probably damaging 0.99
R3738:Jak1 UTSW 4 101191468 unclassified probably benign
R4172:Jak1 UTSW 4 101159132 missense probably benign 0.08
R4505:Jak1 UTSW 4 101154603 missense probably benign
R4602:Jak1 UTSW 4 101179594 missense possibly damaging 0.83
R4755:Jak1 UTSW 4 101174157 missense probably damaging 1.00
R4836:Jak1 UTSW 4 101155066 missense probably damaging 0.97
R4908:Jak1 UTSW 4 101179714 missense probably damaging 1.00
R5116:Jak1 UTSW 4 101155113 missense probably benign
R6190:Jak1 UTSW 4 101175128 missense probably damaging 1.00
R6339:Jak1 UTSW 4 101161926 missense probably damaging 0.99
R6500:Jak1 UTSW 4 101181933 missense probably benign 0.43
R6551:Jak1 UTSW 4 101193843 start gained probably benign
R6895:Jak1 UTSW 4 101154537 critical splice donor site probably null
R7163:Jak1 UTSW 4 101175188 missense probably damaging 1.00
R7204:Jak1 UTSW 4 101175135 missense probably benign 0.02
R7361:Jak1 UTSW 4 101184339 missense possibly damaging 0.86
R7408:Jak1 UTSW 4 101175182 missense probably damaging 0.96
R7513:Jak1 UTSW 4 101191651 missense probably damaging 0.96
R7617:Jak1 UTSW 4 101174211 critical splice acceptor site probably null
R7779:Jak1 UTSW 4 101160142 missense probably benign
Z1176:Jak1 UTSW 4 101163681 missense probably damaging 1.00
Z1176:Jak1 UTSW 4 101163722 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- ATGGCCAGACTCTCCCATTC -3'
(R):5'- GCAGTGGACTTTACTTGGACC -3'

Sequencing Primer
(F):5'- GAGCAGCTGATACGCACC -3'
(R):5'- CAACCTGAAGTGACTTTTTCAGTGG -3'
Posted On2015-03-25