Incidental Mutation 'R3779:Klrb1c'
ID271960
Institutional Source Beutler Lab
Gene Symbol Klrb1c
Ensembl Gene ENSMUSG00000030325
Gene Namekiller cell lectin-like receptor subfamily B member 1C
SynonymsNK-RP1, Nk1.1, Nk1, Ly-59, Ly59, Ly55c, CD161, Nkrp1-c, Nk-1, NKR-P1C, NK-1.1, Nk-1.2, NKR-P1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R3779 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location128778485-128789215 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 128780343 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 253 (D253G)
Ref Sequence ENSEMBL: ENSMUSP00000134504 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167691] [ENSMUST00000174404] [ENSMUST00000174865] [ENSMUST00000204394] [ENSMUST00000204423] [ENSMUST00000204677] [ENSMUST00000204756]
Predicted Effect probably damaging
Transcript: ENSMUST00000167691
AA Change: D250G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127297
Gene: ENSMUSG00000030325
AA Change: D250G

DomainStartEndE-ValueType
transmembrane domain 87 109 N/A INTRINSIC
CLECT 139 256 1.65e-25 SMART
Predicted Effect unknown
Transcript: ENSMUST00000172601
AA Change: D200G
SMART Domains Protein: ENSMUSP00000134184
Gene: ENSMUSG00000030325
AA Change: D200G

DomainStartEndE-ValueType
transmembrane domain 41 63 N/A INTRINSIC
CLECT 90 207 1.65e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000174404
AA Change: D253G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134504
Gene: ENSMUSG00000030325
AA Change: D253G

DomainStartEndE-ValueType
transmembrane domain 87 109 N/A INTRINSIC
CLECT 142 259 1.65e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174865
SMART Domains Protein: ENSMUSP00000134055
Gene: ENSMUSG00000030325

DomainStartEndE-ValueType
transmembrane domain 76 98 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000204394
AA Change: D205G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000145481
Gene: ENSMUSG00000107872
AA Change: D205G

DomainStartEndE-ValueType
transmembrane domain 44 66 N/A INTRINSIC
CLECT 94 211 8.5e-28 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000204423
AA Change: D205G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000145327
Gene: ENSMUSG00000107872
AA Change: D205G

DomainStartEndE-ValueType
transmembrane domain 44 66 N/A INTRINSIC
CLECT 94 211 8.7e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204677
SMART Domains Protein: ENSMUSP00000145287
Gene: ENSMUSG00000107872

DomainStartEndE-ValueType
transmembrane domain 44 66 N/A INTRINSIC
PDB:3M9Z|A 89 144 2e-30 PDB
SCOP:d1e87a_ 94 143 2e-12 SMART
Blast:CLECT 94 144 3e-30 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000204756
SMART Domains Protein: ENSMUSP00000144777
Gene: ENSMUSG00000107872

DomainStartEndE-ValueType
transmembrane domain 35 57 N/A INTRINSIC
CLECT 85 185 1e-14 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 98% (47/48)
MGI Phenotype PHENOTYPE: This locus controls an antigen on natural killer cells. The a allele determines the Nk1.1 antigen in strains CE, C57BL/6, C57BR/cd, C57L, C58, DBA/1, MA/My, NZB, SJL, SM and B10.D2. The b allele determines the Nk1.2 antigen in strains CBA/J, BALB/c, C3H/He, A/J, DBA/2, LP and 129. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310079G19Rik A G 16: 88,627,385 C73R probably damaging Het
Acot10 A G 15: 20,665,542 V371A probably damaging Het
Ambn C A 5: 88,465,342 probably benign Het
Ankrd34a T C 3: 96,598,931 F484L possibly damaging Het
Bcl11a A G 11: 24,164,568 K637R probably damaging Het
Cenpe T C 3: 135,256,576 S1968P possibly damaging Het
Cfap61 T C 2: 145,950,794 I52T probably damaging Het
Cit A T 5: 115,859,341 M128L probably benign Het
Cnga1 G T 5: 72,604,783 L463I probably damaging Het
Dnah11 C T 12: 118,130,713 probably benign Het
Elovl4 ACT A 9: 83,785,148 probably null Het
Ep400 A G 5: 110,691,649 I1853T unknown Het
Flg2 C T 3: 93,202,423 S586L unknown Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably benign Het
Gm21886 G T 18: 80,089,434 Q170K possibly damaging Het
Gm5819 A G 18: 8,694,429 E118G probably damaging Het
Gm9376 T C 14: 118,267,315 V53A probably benign Het
H2-T3 T C 17: 36,189,682 T90A probably damaging Het
Hif1an A G 19: 44,569,408 D243G probably damaging Het
Hmgcs2 C T 3: 98,299,112 probably benign Het
Ighv1-72 A T 12: 115,758,016 S107T probably damaging Het
Jak1 G A 4: 101,156,490 H1014Y probably benign Het
Lpin1 G A 12: 16,564,568 T404M probably damaging Het
Map3k9 A T 12: 81,743,791 probably benign Het
Myl12a G T 17: 70,994,636 H165Q possibly damaging Het
Olfr768 A G 10: 129,093,296 F226S possibly damaging Het
Pdgfrb T A 18: 61,072,666 S575T probably damaging Het
Phldb2 T C 16: 45,748,755 Y1247C probably damaging Het
Pinlyp T A 7: 24,541,835 T181S probably benign Het
Pkn2 A G 3: 142,793,980 V928A possibly damaging Het
Skint5 C T 4: 113,779,040 probably benign Het
Skiv2l2 A T 13: 112,903,392 probably benign Het
Slc24a1 A G 9: 64,948,297 Y443H unknown Het
Sp8 G T 12: 118,849,015 V202L possibly damaging Het
Svil A G 18: 5,090,855 N915S probably damaging Het
Syncrip A C 9: 88,476,939 D172E probably damaging Het
Tex26 T C 5: 149,445,851 I48T probably damaging Het
Trpm6 A C 19: 18,876,039 I1808L possibly damaging Het
Uba2 T C 7: 34,154,646 probably null Het
Vwa8 T A 14: 79,102,322 probably benign Het
Wfs1 C A 5: 36,968,624 V308L probably benign Het
Wrn T A 8: 33,241,020 R1095W probably damaging Het
Zfp808 T A 13: 62,171,903 N315K probably damaging Het
Other mutations in Klrb1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02636:Klrb1c APN 6 128788552 missense probably benign 0.01
Freakish UTSW 6 128784185 missense probably benign 0.38
R3157_klrb1c_539 UTSW 6 128784739 missense possibly damaging 0.88
Unnatural UTSW 6 128784211 missense probably benign 0.09
wacky UTSW 6 128780343 missense probably damaging 1.00
Weird UTSW 6 128784257 missense probably benign 0.00
Wild UTSW 6 128786005 missense probably benign 0.09
R0463:Klrb1c UTSW 6 128780403 missense probably benign 0.07
R3157:Klrb1c UTSW 6 128784739 missense possibly damaging 0.88
R5111:Klrb1c UTSW 6 128786005 missense probably benign 0.09
R5149:Klrb1c UTSW 6 128783707 missense probably benign 0.07
R5196:Klrb1c UTSW 6 128780299 missense probably benign 0.00
R5568:Klrb1c UTSW 6 128788914 intron probably benign
R5620:Klrb1c UTSW 6 128784743 missense possibly damaging 0.67
R6000:Klrb1c UTSW 6 128784157 missense probably damaging 1.00
R6483:Klrb1c UTSW 6 128784185 missense probably benign 0.38
R6854:Klrb1c UTSW 6 128788418 missense possibly damaging 0.87
R7283:Klrb1c UTSW 6 128784257 missense probably benign 0.00
R7697:Klrb1c UTSW 6 128780310 missense probably benign 0.02
R7946:Klrb1c UTSW 6 128789109 intron probably benign
R8789:Klrb1c UTSW 6 128784185 missense probably benign 0.38
Z1177:Klrb1c UTSW 6 128788447 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAACTGTGTCTGTGTACACTG -3'
(R):5'- CCATAGTCCTTAGAAGTCTAGAGGAG -3'

Sequencing Primer
(F):5'- TAAGAGGCCCAGTGCTTTCAG -3'
(R):5'- TCTAGAGGAGAAGATGGCCAACTC -3'
Posted On2015-03-25