Incidental Mutation 'R3779:Bcl11a'
ID271971
Institutional Source Beutler Lab
Gene Symbol Bcl11a
Ensembl Gene ENSMUSG00000000861
Gene NameB cell CLL/lymphoma 11A (zinc finger protein)
Synonyms2810047E18Rik, Evi9c, Evi9, Evi9b, Evi9a, COUP-TF interacting protein 1, D930021L15Rik, CTIP1, mouse myeloid leukemia gene
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3779 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location24078056-24174123 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24164568 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 637 (K637R)
Ref Sequence ENSEMBL: ENSMUSP00000105140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000881] [ENSMUST00000109514] [ENSMUST00000109516] [ENSMUST00000118955]
Predicted Effect probably damaging
Transcript: ENSMUST00000000881
AA Change: K637R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000000881
Gene: ENSMUSG00000000861
AA Change: K637R

DomainStartEndE-ValueType
Pfam:zf-C2H2_6 45 73 5.9e-9 PFAM
ZnF_C2H2 170 193 7.15e-2 SMART
low complexity region 258 274 N/A INTRINSIC
low complexity region 327 338 N/A INTRINSIC
low complexity region 352 373 N/A INTRINSIC
ZnF_C2H2 377 399 6.23e-2 SMART
ZnF_C2H2 405 427 1.69e-3 SMART
low complexity region 456 472 N/A INTRINSIC
coiled coil region 481 513 N/A INTRINSIC
low complexity region 614 634 N/A INTRINSIC
low complexity region 682 696 N/A INTRINSIC
low complexity region 708 731 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109514
AA Change: K637R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105140
Gene: ENSMUSG00000000861
AA Change: K637R

DomainStartEndE-ValueType
Blast:ZnF_C2H2 46 72 8e-10 BLAST
ZnF_C2H2 170 193 7.15e-2 SMART
low complexity region 258 274 N/A INTRINSIC
low complexity region 327 338 N/A INTRINSIC
low complexity region 352 373 N/A INTRINSIC
ZnF_C2H2 377 399 6.23e-2 SMART
ZnF_C2H2 405 427 1.69e-3 SMART
low complexity region 456 472 N/A INTRINSIC
coiled coil region 481 513 N/A INTRINSIC
low complexity region 614 634 N/A INTRINSIC
low complexity region 682 696 N/A INTRINSIC
low complexity region 708 731 N/A INTRINSIC
ZnF_C2H2 742 764 1.41e0 SMART
ZnF_C2H2 770 792 4.24e-4 SMART
ZnF_C2H2 800 823 3.07e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109516
SMART Domains Protein: ENSMUSP00000105142
Gene: ENSMUSG00000000861

DomainStartEndE-ValueType
Pfam:zf-C2H2_6 45 73 3.2e-8 PFAM
ZnF_C2H2 170 193 7.15e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118955
SMART Domains Protein: ENSMUSP00000112948
Gene: ENSMUSG00000000861

DomainStartEndE-ValueType
ZnF_C2H2 118 141 7.15e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127494
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131383
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146717
Meta Mutation Damage Score 0.1513 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a C2H2 type zinc-finger protein by its similarity to the mouse Bcl11a/Evi9 protein. The corresponding mouse gene is a common site of retroviral integration in myeloid leukemia, and may function as a leukemia disease gene, in part, through its interaction with BCL6. During hematopoietic cell differentiation, this gene is down-regulated. It is possibly involved in lymphoma pathogenesis since translocations associated with B-cell malignancies also deregulates its expression. Multiple transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in B cell deficiency, alteration of T cell types, and neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310079G19Rik A G 16: 88,627,385 C73R probably damaging Het
Acot10 A G 15: 20,665,542 V371A probably damaging Het
Ambn C A 5: 88,465,342 probably benign Het
Ankrd34a T C 3: 96,598,931 F484L possibly damaging Het
Cenpe T C 3: 135,256,576 S1968P possibly damaging Het
Cfap61 T C 2: 145,950,794 I52T probably damaging Het
Cit A T 5: 115,859,341 M128L probably benign Het
Cnga1 G T 5: 72,604,783 L463I probably damaging Het
Dnah11 C T 12: 118,130,713 probably benign Het
Elovl4 ACT A 9: 83,785,148 probably null Het
Ep400 A G 5: 110,691,649 I1853T unknown Het
Flg2 C T 3: 93,202,423 S586L unknown Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably benign Het
Gm21886 G T 18: 80,089,434 Q170K possibly damaging Het
Gm5819 A G 18: 8,694,429 E118G probably damaging Het
Gm9376 T C 14: 118,267,315 V53A probably benign Het
H2-T3 T C 17: 36,189,682 T90A probably damaging Het
Hif1an A G 19: 44,569,408 D243G probably damaging Het
Hmgcs2 C T 3: 98,299,112 probably benign Het
Ighv1-72 A T 12: 115,758,016 S107T probably damaging Het
Jak1 G A 4: 101,156,490 H1014Y probably benign Het
Klrb1c T C 6: 128,780,343 D253G probably damaging Het
Lpin1 G A 12: 16,564,568 T404M probably damaging Het
Map3k9 A T 12: 81,743,791 probably benign Het
Myl12a G T 17: 70,994,636 H165Q possibly damaging Het
Olfr768 A G 10: 129,093,296 F226S possibly damaging Het
Pdgfrb T A 18: 61,072,666 S575T probably damaging Het
Phldb2 T C 16: 45,748,755 Y1247C probably damaging Het
Pinlyp T A 7: 24,541,835 T181S probably benign Het
Pkn2 A G 3: 142,793,980 V928A possibly damaging Het
Skint5 C T 4: 113,779,040 probably benign Het
Skiv2l2 A T 13: 112,903,392 probably benign Het
Slc24a1 A G 9: 64,948,297 Y443H unknown Het
Sp8 G T 12: 118,849,015 V202L possibly damaging Het
Svil A G 18: 5,090,855 N915S probably damaging Het
Syncrip A C 9: 88,476,939 D172E probably damaging Het
Tex26 T C 5: 149,445,851 I48T probably damaging Het
Trpm6 A C 19: 18,876,039 I1808L possibly damaging Het
Uba2 T C 7: 34,154,646 probably null Het
Vwa8 T A 14: 79,102,322 probably benign Het
Wfs1 C A 5: 36,968,624 V308L probably benign Het
Wrn T A 8: 33,241,020 R1095W probably damaging Het
Zfp808 T A 13: 62,171,903 N315K probably damaging Het
Other mutations in Bcl11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Bcl11a APN 11 24163346 missense probably benign 0.00
IGL03190:Bcl11a APN 11 24158333 missense probably benign 0.00
R0317:Bcl11a UTSW 11 24172697 critical splice acceptor site probably null
R1061:Bcl11a UTSW 11 24164069 nonsense probably null
R1124:Bcl11a UTSW 11 24163928 missense probably damaging 1.00
R1163:Bcl11a UTSW 11 24165143 missense probably benign 0.41
R1498:Bcl11a UTSW 11 24164005 missense probably damaging 1.00
R1599:Bcl11a UTSW 11 24163887 missense probably damaging 1.00
R1689:Bcl11a UTSW 11 24163167 missense probably damaging 1.00
R1689:Bcl11a UTSW 11 24164406 missense possibly damaging 0.66
R1754:Bcl11a UTSW 11 24164724 missense probably damaging 1.00
R2036:Bcl11a UTSW 11 24164087 missense possibly damaging 0.71
R2207:Bcl11a UTSW 11 24163343 missense probably damaging 1.00
R3700:Bcl11a UTSW 11 24163890 missense probably damaging 1.00
R4557:Bcl11a UTSW 11 24164004 missense probably damaging 1.00
R4703:Bcl11a UTSW 11 24163725 missense possibly damaging 0.80
R5006:Bcl11a UTSW 11 24164989 nonsense probably null
R5053:Bcl11a UTSW 11 24164068 missense probably benign 0.03
R5495:Bcl11a UTSW 11 24165042 missense possibly damaging 0.73
R5581:Bcl11a UTSW 11 24163932 missense probably damaging 1.00
R5680:Bcl11a UTSW 11 24164264 missense possibly damaging 0.52
R5790:Bcl11a UTSW 11 24163650 missense probably damaging 1.00
R6291:Bcl11a UTSW 11 24158321 missense probably damaging 0.96
R6723:Bcl11a UTSW 11 24163646 missense probably damaging 1.00
R7116:Bcl11a UTSW 11 24163839 missense probably damaging 1.00
R7274:Bcl11a UTSW 11 24163985 missense probably damaging 1.00
R7569:Bcl11a UTSW 11 24085458 nonsense probably null
R7843:Bcl11a UTSW 11 24164831 missense probably benign 0.26
R7926:Bcl11a UTSW 11 24164831 missense probably benign 0.26
Z1176:Bcl11a UTSW 11 24165010 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCATAGGGACACTTGTGATGAAG -3'
(R):5'- ACTAATATGGGGCGTGCTCC -3'

Sequencing Primer
(F):5'- ACACTTGTGATGAAGACTCGGTG -3'
(R):5'- TGAGATCCCTCCGTCCAG -3'
Posted On2015-03-25