Incidental Mutation 'R3779:Map3k9'
ID271973
Institutional Source Beutler Lab
Gene Symbol Map3k9
Ensembl Gene ENSMUSG00000042724
Gene Namemitogen-activated protein kinase kinase kinase 9
SynonymsMlk1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3779 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location81721010-81781175 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 81743791 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035987] [ENSMUST00000222322]
Predicted Effect probably benign
Transcript: ENSMUST00000035987
SMART Domains Protein: ENSMUSP00000041819
Gene: ENSMUSG00000042724

DomainStartEndE-ValueType
low complexity region 14 40 N/A INTRINSIC
SH3 48 108 1.61e-20 SMART
TyrKc 137 396 6.72e-89 SMART
low complexity region 449 469 N/A INTRINSIC
low complexity region 573 590 N/A INTRINSIC
low complexity region 644 657 N/A INTRINSIC
low complexity region 722 736 N/A INTRINSIC
low complexity region 749 765 N/A INTRINSIC
low complexity region 772 783 N/A INTRINSIC
low complexity region 799 811 N/A INTRINSIC
low complexity region 901 915 N/A INTRINSIC
low complexity region 1020 1036 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000222322
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223292
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 98% (47/48)
MGI Phenotype PHENOTYPE: Mice homozygous for a reporter/null allele exhibit normal development, reproduction and lifespan. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310079G19Rik A G 16: 88,627,385 C73R probably damaging Het
Acot10 A G 15: 20,665,542 V371A probably damaging Het
Ambn C A 5: 88,465,342 probably benign Het
Ankrd34a T C 3: 96,598,931 F484L possibly damaging Het
Bcl11a A G 11: 24,164,568 K637R probably damaging Het
Cenpe T C 3: 135,256,576 S1968P possibly damaging Het
Cfap61 T C 2: 145,950,794 I52T probably damaging Het
Cit A T 5: 115,859,341 M128L probably benign Het
Cnga1 G T 5: 72,604,783 L463I probably damaging Het
Dnah11 C T 12: 118,130,713 probably benign Het
Elovl4 ACT A 9: 83,785,148 probably null Het
Ep400 A G 5: 110,691,649 I1853T unknown Het
Flg2 C T 3: 93,202,423 S586L unknown Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably benign Het
Gm21886 G T 18: 80,089,434 Q170K possibly damaging Het
Gm5819 A G 18: 8,694,429 E118G probably damaging Het
Gm9376 T C 14: 118,267,315 V53A probably benign Het
H2-T3 T C 17: 36,189,682 T90A probably damaging Het
Hif1an A G 19: 44,569,408 D243G probably damaging Het
Hmgcs2 C T 3: 98,299,112 probably benign Het
Ighv1-72 A T 12: 115,758,016 S107T probably damaging Het
Jak1 G A 4: 101,156,490 H1014Y probably benign Het
Klrb1c T C 6: 128,780,343 D253G probably damaging Het
Lpin1 G A 12: 16,564,568 T404M probably damaging Het
Myl12a G T 17: 70,994,636 H165Q possibly damaging Het
Olfr768 A G 10: 129,093,296 F226S possibly damaging Het
Pdgfrb T A 18: 61,072,666 S575T probably damaging Het
Phldb2 T C 16: 45,748,755 Y1247C probably damaging Het
Pinlyp T A 7: 24,541,835 T181S probably benign Het
Pkn2 A G 3: 142,793,980 V928A possibly damaging Het
Skint5 C T 4: 113,779,040 probably benign Het
Skiv2l2 A T 13: 112,903,392 probably benign Het
Slc24a1 A G 9: 64,948,297 Y443H unknown Het
Sp8 G T 12: 118,849,015 V202L possibly damaging Het
Svil A G 18: 5,090,855 N915S probably damaging Het
Syncrip A C 9: 88,476,939 D172E probably damaging Het
Tex26 T C 5: 149,445,851 I48T probably damaging Het
Trpm6 A C 19: 18,876,039 I1808L possibly damaging Het
Uba2 T C 7: 34,154,646 probably null Het
Vwa8 T A 14: 79,102,322 probably benign Het
Wfs1 C A 5: 36,968,624 V308L probably benign Het
Wrn T A 8: 33,241,020 R1095W probably damaging Het
Zfp808 T A 13: 62,171,903 N315K probably damaging Het
Other mutations in Map3k9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00640:Map3k9 APN 12 81729698 missense probably benign 0.00
IGL01098:Map3k9 APN 12 81724154 missense probably damaging 1.00
IGL01122:Map3k9 APN 12 81732126 missense possibly damaging 0.94
IGL01680:Map3k9 APN 12 81724739 missense probably benign 0.10
IGL01997:Map3k9 APN 12 81772697 missense probably damaging 1.00
IGL02178:Map3k9 APN 12 81743837 missense probably damaging 1.00
IGL02724:Map3k9 APN 12 81724742 missense probably benign
PIT4366001:Map3k9 UTSW 12 81772761 missense possibly damaging 0.95
R0530:Map3k9 UTSW 12 81722482 missense probably benign 0.00
R0541:Map3k9 UTSW 12 81734223 missense possibly damaging 0.79
R0550:Map3k9 UTSW 12 81725781 missense probably damaging 1.00
R0799:Map3k9 UTSW 12 81722269 missense probably benign 0.27
R1730:Map3k9 UTSW 12 81722226 missense probably damaging 0.99
R1783:Map3k9 UTSW 12 81722226 missense probably damaging 0.99
R1859:Map3k9 UTSW 12 81724482 missense possibly damaging 0.82
R1917:Map3k9 UTSW 12 81780790 nonsense probably null
R3121:Map3k9 UTSW 12 81743924 missense probably damaging 1.00
R3931:Map3k9 UTSW 12 81772917 missense probably damaging 0.99
R3951:Map3k9 UTSW 12 81722521 missense probably benign
R4571:Map3k9 UTSW 12 81734091 missense probably benign 0.25
R4728:Map3k9 UTSW 12 81722373 missense probably damaging 0.96
R4857:Map3k9 UTSW 12 81724627 missense probably benign 0.42
R4882:Map3k9 UTSW 12 81724162 missense probably damaging 1.00
R5077:Map3k9 UTSW 12 81734077 splice site probably null
R5369:Map3k9 UTSW 12 81722052 missense probably damaging 0.98
R5418:Map3k9 UTSW 12 81743817 nonsense probably null
R5540:Map3k9 UTSW 12 81772813 missense probably damaging 1.00
R5567:Map3k9 UTSW 12 81732024 missense possibly damaging 0.67
R5570:Map3k9 UTSW 12 81732024 missense possibly damaging 0.67
R5696:Map3k9 UTSW 12 81734122 missense probably benign 0.00
R6539:Map3k9 UTSW 12 81732192 missense probably damaging 0.98
R6542:Map3k9 UTSW 12 81722254 missense possibly damaging 0.91
R6816:Map3k9 UTSW 12 81722254 missense possibly damaging 0.91
R6964:Map3k9 UTSW 12 81773003 missense probably benign 0.00
R7027:Map3k9 UTSW 12 81730624 missense probably benign 0.06
R7055:Map3k9 UTSW 12 81724208 missense probably damaging 0.99
R7082:Map3k9 UTSW 12 81724702 missense probably damaging 1.00
R7247:Map3k9 UTSW 12 81725830 missense possibly damaging 0.65
R7424:Map3k9 UTSW 12 81724097 missense probably benign 0.00
R7476:Map3k9 UTSW 12 81743808 missense probably damaging 1.00
R7638:Map3k9 UTSW 12 81724732 missense probably benign 0.00
X0025:Map3k9 UTSW 12 81724412 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- CTGAGGAGCCATCTACTACGTG -3'
(R):5'- AGGCCCTGTGACTAATGCTTATC -3'

Sequencing Primer
(F):5'- GGAGCCATCTACTACGTGCAATG -3'
(R):5'- CGCTCAGTATTGATCCTGCAGAAAG -3'
Posted On2015-03-25