Incidental Mutation 'R3779:Dnah11'
ID 271974
Institutional Source Beutler Lab
Gene Symbol Dnah11
Ensembl Gene ENSMUSG00000018581
Gene Name dynein, axonemal, heavy chain 11
Synonyms b2b598Clo, b2b1289Clo, b2b1203Clo, Dnahc11, avc4, b2b1279Clo, b2b1727Clo, lrd
Accession Numbers
Essential gene? Possibly essential (E-score: 0.603) question?
Stock # R3779 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 117841717-118162778 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) C to T at 118094448 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000081867 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084806]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000084806
SMART Domains Protein: ENSMUSP00000081867
Gene: ENSMUSG00000018581

DomainStartEndE-ValueType
low complexity region 18 28 N/A INTRINSIC
Pfam:DHC_N1 218 794 1.6e-162 PFAM
low complexity region 1266 1282 N/A INTRINSIC
Pfam:DHC_N2 1297 1705 1e-130 PFAM
low complexity region 1757 1773 N/A INTRINSIC
AAA 1869 1963 1.51e0 SMART
Pfam:AAA_5 2150 2286 1.6e-12 PFAM
AAA 2474 2619 1.48e-1 SMART
AAA 2819 2931 4.57e-1 SMART
Pfam:MT 3069 3413 3.2e-162 PFAM
Pfam:AAA_9 3434 3656 2.9e-88 PFAM
Pfam:Dynein_heavy 3790 4486 7.1e-235 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ciliary outer dynein arm protein and is a member of the dynein heavy chain family. It is a microtubule-dependent motor ATPase and has been reported to be involved in the movement of respiratory cilia. Mutations in this gene have been implicated in causing Kartagener Syndrome (a combination of situs inversus totalis and Primary Ciliary Dyskinesia (PCD), also called Immotile Cilia Syndrome 1 (ICS1)) and male sterility. [provided by RefSeq, Mar 2013]
PHENOTYPE: Approximately half of live-born homozygous mutants show situs inversus indicating that this gene is no longer properly controlling left-right asymmetry. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310079G19Rik A G 16: 88,424,273 (GRCm39) C73R probably damaging Het
Acot10 A G 15: 20,665,628 (GRCm39) V371A probably damaging Het
Ambn C A 5: 88,613,201 (GRCm39) probably benign Het
Ankrd34a T C 3: 96,506,247 (GRCm39) F484L possibly damaging Het
Bcl11a A G 11: 24,114,568 (GRCm39) K637R probably damaging Het
Cenpe T C 3: 134,962,337 (GRCm39) S1968P possibly damaging Het
Cfap61 T C 2: 145,792,714 (GRCm39) I52T probably damaging Het
Cit A T 5: 115,997,400 (GRCm39) M128L probably benign Het
Cnga1 G T 5: 72,762,126 (GRCm39) L463I probably damaging Het
Elovl4 ACT A 9: 83,667,201 (GRCm39) probably null Het
Ep400 A G 5: 110,839,515 (GRCm39) I1853T unknown Het
Flg2 C T 3: 93,109,730 (GRCm39) S586L unknown Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 118,989,784 (GRCm39) probably benign Het
Gm21886 G T 18: 80,132,649 (GRCm39) Q170K possibly damaging Het
Gm5819 A G 18: 8,694,429 (GRCm39) E118G probably damaging Het
Gm9376 T C 14: 118,504,727 (GRCm39) V53A probably benign Het
H2-T3 T C 17: 36,500,574 (GRCm39) T90A probably damaging Het
Hif1an A G 19: 44,557,847 (GRCm39) D243G probably damaging Het
Hmgcs2 C T 3: 98,206,428 (GRCm39) probably benign Het
Ighv1-72 A T 12: 115,721,636 (GRCm39) S107T probably damaging Het
Jak1 G A 4: 101,013,687 (GRCm39) H1014Y probably benign Het
Klrb1c T C 6: 128,757,306 (GRCm39) D253G probably damaging Het
Lpin1 G A 12: 16,614,569 (GRCm39) T404M probably damaging Het
Map3k9 A T 12: 81,790,565 (GRCm39) probably benign Het
Mtrex A T 13: 113,039,926 (GRCm39) probably benign Het
Myl12a G T 17: 71,301,631 (GRCm39) H165Q possibly damaging Het
Or6c38 A G 10: 128,929,165 (GRCm39) F226S possibly damaging Het
Pdgfrb T A 18: 61,205,738 (GRCm39) S575T probably damaging Het
Phldb2 T C 16: 45,569,118 (GRCm39) Y1247C probably damaging Het
Pinlyp T A 7: 24,241,260 (GRCm39) T181S probably benign Het
Pkn2 A G 3: 142,499,741 (GRCm39) V928A possibly damaging Het
Skint5 C T 4: 113,636,237 (GRCm39) probably benign Het
Slc24a1 A G 9: 64,855,579 (GRCm39) Y443H unknown Het
Sp8 G T 12: 118,812,750 (GRCm39) V202L possibly damaging Het
Svil A G 18: 5,090,855 (GRCm39) N915S probably damaging Het
Syncrip A C 9: 88,358,992 (GRCm39) D172E probably damaging Het
Tex26 T C 5: 149,369,316 (GRCm39) I48T probably damaging Het
Trpm6 A C 19: 18,853,403 (GRCm39) I1808L possibly damaging Het
Uba2 T C 7: 33,854,071 (GRCm39) probably null Het
Vwa8 T A 14: 79,339,762 (GRCm39) probably benign Het
Wfs1 C A 5: 37,125,968 (GRCm39) V308L probably benign Het
Wrn T A 8: 33,731,048 (GRCm39) R1095W probably damaging Het
Zfp808 T A 13: 62,319,717 (GRCm39) N315K probably damaging Het
Other mutations in Dnah11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Dnah11 APN 12 118,162,480 (GRCm39) missense probably benign 0.28
IGL00422:Dnah11 APN 12 118,031,831 (GRCm39) missense probably damaging 1.00
IGL00436:Dnah11 APN 12 118,000,194 (GRCm39) missense possibly damaging 0.56
IGL00540:Dnah11 APN 12 118,150,657 (GRCm39) missense probably benign 0.01
IGL00687:Dnah11 APN 12 117,885,739 (GRCm39) splice site probably benign
IGL00833:Dnah11 APN 12 118,143,315 (GRCm39) missense probably damaging 1.00
IGL00906:Dnah11 APN 12 117,874,937 (GRCm39) missense probably damaging 1.00
IGL00952:Dnah11 APN 12 118,160,386 (GRCm39) missense possibly damaging 0.56
IGL01111:Dnah11 APN 12 118,106,669 (GRCm39) splice site probably benign
IGL01121:Dnah11 APN 12 118,014,430 (GRCm39) missense probably benign 0.02
IGL01143:Dnah11 APN 12 117,976,475 (GRCm39) missense probably damaging 1.00
IGL01359:Dnah11 APN 12 117,946,734 (GRCm39) missense probably damaging 0.99
IGL01372:Dnah11 APN 12 118,156,134 (GRCm39) missense probably damaging 1.00
IGL01410:Dnah11 APN 12 118,010,991 (GRCm39) nonsense probably null
IGL01418:Dnah11 APN 12 117,951,217 (GRCm39) nonsense probably null
IGL01444:Dnah11 APN 12 117,983,967 (GRCm39) missense possibly damaging 0.91
IGL01606:Dnah11 APN 12 117,946,767 (GRCm39) missense probably benign 0.15
IGL01645:Dnah11 APN 12 118,150,733 (GRCm39) missense possibly damaging 0.90
IGL01932:Dnah11 APN 12 118,156,005 (GRCm39) splice site probably benign
IGL02104:Dnah11 APN 12 118,156,125 (GRCm39) missense probably benign
IGL02151:Dnah11 APN 12 118,023,623 (GRCm39) splice site probably benign
IGL02189:Dnah11 APN 12 118,046,314 (GRCm39) missense probably benign 0.00
IGL02417:Dnah11 APN 12 118,020,915 (GRCm39) missense probably damaging 1.00
IGL02421:Dnah11 APN 12 118,150,637 (GRCm39) missense probably damaging 1.00
IGL02444:Dnah11 APN 12 117,939,608 (GRCm39) splice site probably benign
IGL02474:Dnah11 APN 12 117,991,180 (GRCm39) splice site probably null
IGL02526:Dnah11 APN 12 118,143,353 (GRCm39) missense possibly damaging 0.70
IGL02887:Dnah11 APN 12 117,874,775 (GRCm39) missense probably damaging 1.00
IGL03011:Dnah11 APN 12 117,976,112 (GRCm39) missense probably benign 0.08
IGL03061:Dnah11 APN 12 117,866,856 (GRCm39) missense probably damaging 1.00
IGL03182:Dnah11 APN 12 117,994,026 (GRCm39) missense probably damaging 0.99
IGL03220:Dnah11 APN 12 118,069,720 (GRCm39) missense probably benign
IGL03238:Dnah11 APN 12 118,073,633 (GRCm39) missense probably damaging 1.00
IGL03493:Dnah11 APN 12 117,976,533 (GRCm39) missense probably benign 0.00
P0045:Dnah11 UTSW 12 117,994,062 (GRCm39) missense probably benign
R0009:Dnah11 UTSW 12 118,009,257 (GRCm39) missense possibly damaging 0.90
R0066:Dnah11 UTSW 12 118,090,621 (GRCm39) missense probably benign 0.05
R0172:Dnah11 UTSW 12 117,951,188 (GRCm39) missense probably damaging 1.00
R0206:Dnah11 UTSW 12 118,007,509 (GRCm39) missense probably damaging 0.98
R0206:Dnah11 UTSW 12 118,007,509 (GRCm39) missense probably damaging 0.98
R0208:Dnah11 UTSW 12 118,007,509 (GRCm39) missense probably damaging 0.98
R0230:Dnah11 UTSW 12 117,946,791 (GRCm39) nonsense probably null
R0270:Dnah11 UTSW 12 118,004,748 (GRCm39) missense probably damaging 1.00
R0311:Dnah11 UTSW 12 118,090,868 (GRCm39) missense probably benign 0.03
R0325:Dnah11 UTSW 12 117,976,074 (GRCm39) missense probably benign
R0370:Dnah11 UTSW 12 117,958,962 (GRCm39) missense probably benign
R0416:Dnah11 UTSW 12 117,874,793 (GRCm39) missense probably damaging 1.00
R0505:Dnah11 UTSW 12 118,070,245 (GRCm39) missense probably damaging 1.00
R0540:Dnah11 UTSW 12 118,046,246 (GRCm39) missense probably damaging 1.00
R0554:Dnah11 UTSW 12 117,894,913 (GRCm39) missense probably benign 0.01
R0607:Dnah11 UTSW 12 118,046,246 (GRCm39) missense probably damaging 1.00
R0620:Dnah11 UTSW 12 117,951,204 (GRCm39) missense probably damaging 1.00
R0635:Dnah11 UTSW 12 117,971,731 (GRCm39) missense probably damaging 1.00
R0755:Dnah11 UTSW 12 118,162,360 (GRCm39) missense probably benign 0.17
R0755:Dnah11 UTSW 12 117,918,564 (GRCm39) missense possibly damaging 0.95
R0789:Dnah11 UTSW 12 117,874,967 (GRCm39) missense probably damaging 1.00
R0833:Dnah11 UTSW 12 118,160,397 (GRCm39) missense probably benign 0.01
R0835:Dnah11 UTSW 12 117,880,523 (GRCm39) missense probably damaging 1.00
R0836:Dnah11 UTSW 12 118,160,397 (GRCm39) missense probably benign 0.01
R0846:Dnah11 UTSW 12 117,897,585 (GRCm39) missense probably damaging 0.97
R0865:Dnah11 UTSW 12 118,154,579 (GRCm39) nonsense probably null
R0928:Dnah11 UTSW 12 118,009,297 (GRCm39) missense probably damaging 1.00
R0939:Dnah11 UTSW 12 118,024,142 (GRCm39) missense probably damaging 1.00
R1203:Dnah11 UTSW 12 117,897,547 (GRCm39) missense possibly damaging 0.81
R1394:Dnah11 UTSW 12 117,936,099 (GRCm39) missense possibly damaging 0.75
R1398:Dnah11 UTSW 12 118,020,841 (GRCm39) nonsense probably null
R1465:Dnah11 UTSW 12 118,002,430 (GRCm39) missense probably damaging 1.00
R1465:Dnah11 UTSW 12 118,002,430 (GRCm39) missense probably damaging 1.00
R1500:Dnah11 UTSW 12 117,976,564 (GRCm39) splice site probably null
R1535:Dnah11 UTSW 12 117,982,465 (GRCm39) missense probably damaging 1.00
R1539:Dnah11 UTSW 12 117,894,991 (GRCm39) missense probably benign 0.01
R1554:Dnah11 UTSW 12 118,046,234 (GRCm39) missense possibly damaging 0.92
R1574:Dnah11 UTSW 12 118,024,052 (GRCm39) missense probably damaging 1.00
R1574:Dnah11 UTSW 12 118,024,052 (GRCm39) missense probably damaging 1.00
R1615:Dnah11 UTSW 12 118,014,457 (GRCm39) missense probably damaging 1.00
R1618:Dnah11 UTSW 12 117,979,200 (GRCm39) missense probably damaging 0.98
R1638:Dnah11 UTSW 12 117,979,154 (GRCm39) missense possibly damaging 0.81
R1659:Dnah11 UTSW 12 118,084,459 (GRCm39) missense possibly damaging 0.94
R1671:Dnah11 UTSW 12 117,880,523 (GRCm39) missense probably damaging 1.00
R1678:Dnah11 UTSW 12 117,897,580 (GRCm39) missense possibly damaging 0.50
R1699:Dnah11 UTSW 12 118,154,603 (GRCm39) missense probably damaging 1.00
R1712:Dnah11 UTSW 12 118,160,379 (GRCm39) missense probably benign 0.32
R1728:Dnah11 UTSW 12 117,880,666 (GRCm39) missense probably damaging 1.00
R1729:Dnah11 UTSW 12 117,880,666 (GRCm39) missense probably damaging 1.00
R1764:Dnah11 UTSW 12 118,154,560 (GRCm39) missense probably benign 0.31
R1780:Dnah11 UTSW 12 117,991,293 (GRCm39) missense probably damaging 1.00
R1789:Dnah11 UTSW 12 118,002,515 (GRCm39) missense probably damaging 0.99
R1800:Dnah11 UTSW 12 117,880,523 (GRCm39) missense probably damaging 1.00
R1863:Dnah11 UTSW 12 118,027,587 (GRCm39) missense possibly damaging 0.92
R1892:Dnah11 UTSW 12 118,070,209 (GRCm39) missense possibly damaging 0.53
R1907:Dnah11 UTSW 12 118,091,291 (GRCm39) missense possibly damaging 0.66
R1964:Dnah11 UTSW 12 118,106,027 (GRCm39) missense possibly damaging 0.56
R1967:Dnah11 UTSW 12 117,880,523 (GRCm39) missense probably damaging 1.00
R1997:Dnah11 UTSW 12 118,046,203 (GRCm39) missense possibly damaging 0.64
R2086:Dnah11 UTSW 12 118,077,606 (GRCm39) missense possibly damaging 0.82
R2092:Dnah11 UTSW 12 117,976,451 (GRCm39) missense possibly damaging 0.50
R2108:Dnah11 UTSW 12 117,984,088 (GRCm39) missense probably damaging 1.00
R2140:Dnah11 UTSW 12 117,972,545 (GRCm39) missense probably benign 0.01
R2261:Dnah11 UTSW 12 117,930,374 (GRCm39) missense probably damaging 0.99
R2261:Dnah11 UTSW 12 117,843,760 (GRCm39) missense probably benign 0.06
R2262:Dnah11 UTSW 12 117,930,374 (GRCm39) missense probably damaging 0.99
R2262:Dnah11 UTSW 12 117,843,760 (GRCm39) missense probably benign 0.06
R2263:Dnah11 UTSW 12 117,843,760 (GRCm39) missense probably benign 0.06
R2263:Dnah11 UTSW 12 117,930,374 (GRCm39) missense probably damaging 0.99
R2328:Dnah11 UTSW 12 117,850,421 (GRCm39) missense probably damaging 0.98
R2352:Dnah11 UTSW 12 117,892,065 (GRCm39) missense probably damaging 1.00
R2410:Dnah11 UTSW 12 117,991,262 (GRCm39) missense probably damaging 1.00
R2885:Dnah11 UTSW 12 117,951,162 (GRCm39) nonsense probably null
R3499:Dnah11 UTSW 12 117,874,758 (GRCm39) missense probably damaging 1.00
R3741:Dnah11 UTSW 12 118,095,076 (GRCm39) missense probably benign 0.05
R3742:Dnah11 UTSW 12 118,095,076 (GRCm39) missense probably benign 0.05
R3785:Dnah11 UTSW 12 117,981,337 (GRCm39) missense probably damaging 1.00
R3883:Dnah11 UTSW 12 117,942,188 (GRCm39) splice site probably benign
R4014:Dnah11 UTSW 12 117,938,649 (GRCm39) missense probably benign 0.16
R4043:Dnah11 UTSW 12 117,843,678 (GRCm39) missense probably damaging 1.00
R4072:Dnah11 UTSW 12 118,070,227 (GRCm39) missense probably damaging 1.00
R4073:Dnah11 UTSW 12 118,009,413 (GRCm39) missense probably benign 0.01
R4074:Dnah11 UTSW 12 118,009,413 (GRCm39) missense probably benign 0.01
R4076:Dnah11 UTSW 12 118,009,413 (GRCm39) missense probably benign 0.01
R4201:Dnah11 UTSW 12 117,930,394 (GRCm39) missense possibly damaging 0.63
R4224:Dnah11 UTSW 12 118,094,627 (GRCm39) missense probably benign 0.06
R4233:Dnah11 UTSW 12 117,880,526 (GRCm39) missense probably damaging 1.00
R4358:Dnah11 UTSW 12 118,089,578 (GRCm39) nonsense probably null
R4430:Dnah11 UTSW 12 117,946,746 (GRCm39) missense probably benign 0.26
R4465:Dnah11 UTSW 12 117,951,186 (GRCm39) missense probably benign 0.09
R4489:Dnah11 UTSW 12 117,880,631 (GRCm39) missense probably benign 0.31
R4572:Dnah11 UTSW 12 117,973,860 (GRCm39) missense probably benign 0.00
R4574:Dnah11 UTSW 12 117,975,990 (GRCm39) critical splice donor site probably null
R4657:Dnah11 UTSW 12 118,156,162 (GRCm39) missense probably benign 0.02
R4709:Dnah11 UTSW 12 117,982,495 (GRCm39) missense probably benign 0.26
R4740:Dnah11 UTSW 12 118,084,279 (GRCm39) missense probably benign 0.28
R4803:Dnah11 UTSW 12 118,091,343 (GRCm39) missense possibly damaging 0.50
R4896:Dnah11 UTSW 12 117,958,935 (GRCm39) missense probably damaging 1.00
R4908:Dnah11 UTSW 12 118,090,618 (GRCm39) missense probably benign 0.37
R5018:Dnah11 UTSW 12 118,094,463 (GRCm39) missense probably benign 0.00
R5071:Dnah11 UTSW 12 118,046,188 (GRCm39) nonsense probably null
R5074:Dnah11 UTSW 12 118,046,188 (GRCm39) nonsense probably null
R5080:Dnah11 UTSW 12 118,162,565 (GRCm39) start codon destroyed probably null 0.01
R5097:Dnah11 UTSW 12 117,981,435 (GRCm39) missense probably damaging 1.00
R5131:Dnah11 UTSW 12 117,918,486 (GRCm39) missense probably damaging 1.00
R5215:Dnah11 UTSW 12 118,121,096 (GRCm39) missense probably benign 0.09
R5252:Dnah11 UTSW 12 118,089,676 (GRCm39) missense probably damaging 1.00
R5296:Dnah11 UTSW 12 117,847,151 (GRCm39) missense probably damaging 1.00
R5308:Dnah11 UTSW 12 118,049,415 (GRCm39) missense possibly damaging 0.60
R5368:Dnah11 UTSW 12 117,918,628 (GRCm39) missense probably damaging 1.00
R5383:Dnah11 UTSW 12 118,049,432 (GRCm39) missense probably damaging 0.99
R5499:Dnah11 UTSW 12 118,070,209 (GRCm39) missense possibly damaging 0.53
R5503:Dnah11 UTSW 12 117,844,186 (GRCm39) critical splice donor site probably null
R5546:Dnah11 UTSW 12 117,939,583 (GRCm39) missense possibly damaging 0.83
R5578:Dnah11 UTSW 12 117,982,537 (GRCm39) missense probably damaging 0.99
R5657:Dnah11 UTSW 12 117,847,352 (GRCm39) missense probably damaging 1.00
R5702:Dnah11 UTSW 12 118,077,642 (GRCm39) missense probably benign 0.04
R5706:Dnah11 UTSW 12 117,987,670 (GRCm39) missense probably damaging 1.00
R5727:Dnah11 UTSW 12 118,090,841 (GRCm39) missense probably damaging 1.00
R5737:Dnah11 UTSW 12 118,156,125 (GRCm39) missense probably benign
R5884:Dnah11 UTSW 12 118,141,269 (GRCm39) missense probably benign 0.00
R5900:Dnah11 UTSW 12 118,046,166 (GRCm39) splice site probably null
R5905:Dnah11 UTSW 12 117,918,659 (GRCm39) missense probably damaging 1.00
R5928:Dnah11 UTSW 12 117,878,371 (GRCm39) splice site probably null
R5973:Dnah11 UTSW 12 118,074,687 (GRCm39) missense probably benign 0.02
R6024:Dnah11 UTSW 12 117,994,007 (GRCm39) missense probably benign 0.34
R6056:Dnah11 UTSW 12 117,892,191 (GRCm39) missense probably benign 0.03
R6075:Dnah11 UTSW 12 118,068,586 (GRCm39) missense probably damaging 1.00
R6092:Dnah11 UTSW 12 117,892,191 (GRCm39) missense probably benign
R6191:Dnah11 UTSW 12 118,154,632 (GRCm39) missense probably benign
R6197:Dnah11 UTSW 12 118,143,482 (GRCm39) missense probably benign 0.03
R6262:Dnah11 UTSW 12 117,894,913 (GRCm39) missense probably damaging 0.98
R6321:Dnah11 UTSW 12 118,106,027 (GRCm39) missense possibly damaging 0.56
R6454:Dnah11 UTSW 12 117,880,590 (GRCm39) missense probably benign 0.01
R6614:Dnah11 UTSW 12 117,850,411 (GRCm39) missense possibly damaging 0.72
R6694:Dnah11 UTSW 12 118,150,617 (GRCm39) splice site probably null
R6712:Dnah11 UTSW 12 118,014,457 (GRCm39) missense probably damaging 1.00
R6720:Dnah11 UTSW 12 118,009,381 (GRCm39) missense probably damaging 1.00
R6742:Dnah11 UTSW 12 118,077,629 (GRCm39) missense possibly damaging 0.82
R6806:Dnah11 UTSW 12 117,951,411 (GRCm39) splice site probably null
R6895:Dnah11 UTSW 12 117,958,926 (GRCm39) missense probably damaging 0.99
R6939:Dnah11 UTSW 12 118,070,297 (GRCm39) missense probably damaging 1.00
R6940:Dnah11 UTSW 12 118,162,503 (GRCm39) missense probably benign
R6945:Dnah11 UTSW 12 118,024,045 (GRCm39) missense probably damaging 1.00
R6958:Dnah11 UTSW 12 117,897,544 (GRCm39) missense probably damaging 1.00
R6970:Dnah11 UTSW 12 118,072,679 (GRCm39) missense probably benign 0.00
R6976:Dnah11 UTSW 12 118,162,378 (GRCm39) missense probably benign 0.16
R7000:Dnah11 UTSW 12 117,981,396 (GRCm39) missense probably damaging 1.00
R7011:Dnah11 UTSW 12 117,885,753 (GRCm39) frame shift probably null
R7101:Dnah11 UTSW 12 118,031,880 (GRCm39) missense probably benign
R7106:Dnah11 UTSW 12 117,924,884 (GRCm39) missense probably benign 0.15
R7203:Dnah11 UTSW 12 118,009,257 (GRCm39) missense possibly damaging 0.90
R7219:Dnah11 UTSW 12 118,090,624 (GRCm39) missense probably benign 0.00
R7219:Dnah11 UTSW 12 118,004,830 (GRCm39) missense possibly damaging 0.95
R7308:Dnah11 UTSW 12 117,959,010 (GRCm39) missense probably damaging 1.00
R7361:Dnah11 UTSW 12 117,982,477 (GRCm39) missense probably damaging 1.00
R7367:Dnah11 UTSW 12 117,951,177 (GRCm39) missense possibly damaging 0.59
R7399:Dnah11 UTSW 12 118,089,520 (GRCm39) missense probably damaging 1.00
R7399:Dnah11 UTSW 12 117,991,212 (GRCm39) missense probably benign 0.00
R7404:Dnah11 UTSW 12 118,068,543 (GRCm39) missense probably benign 0.36
R7473:Dnah11 UTSW 12 117,866,911 (GRCm39) missense probably benign 0.19
R7545:Dnah11 UTSW 12 117,894,939 (GRCm39) missense probably damaging 1.00
R7608:Dnah11 UTSW 12 118,104,505 (GRCm39) splice site probably null
R7625:Dnah11 UTSW 12 118,160,377 (GRCm39) missense probably benign
R7761:Dnah11 UTSW 12 117,987,648 (GRCm39) missense probably damaging 1.00
R7879:Dnah11 UTSW 12 118,004,744 (GRCm39) missense probably damaging 1.00
R7881:Dnah11 UTSW 12 117,951,237 (GRCm39) missense probably benign 0.04
R7904:Dnah11 UTSW 12 117,867,003 (GRCm39) missense possibly damaging 0.72
R8100:Dnah11 UTSW 12 117,930,368 (GRCm39) missense probably damaging 0.99
R8179:Dnah11 UTSW 12 117,842,284 (GRCm39) missense possibly damaging 0.90
R8192:Dnah11 UTSW 12 117,976,181 (GRCm39) missense probably benign
R8254:Dnah11 UTSW 12 117,842,259 (GRCm39) missense possibly damaging 0.89
R8268:Dnah11 UTSW 12 117,991,243 (GRCm39) nonsense probably null
R8272:Dnah11 UTSW 12 118,074,752 (GRCm39) missense probably benign 0.01
R8344:Dnah11 UTSW 12 118,049,466 (GRCm39) missense probably benign 0.00
R8515:Dnah11 UTSW 12 117,939,533 (GRCm39) missense probably damaging 1.00
R8528:Dnah11 UTSW 12 117,972,538 (GRCm39) missense probably damaging 0.96
R8557:Dnah11 UTSW 12 117,842,247 (GRCm39) missense probably benign
R8676:Dnah11 UTSW 12 118,154,539 (GRCm39) missense probably damaging 1.00
R8738:Dnah11 UTSW 12 118,049,384 (GRCm39) critical splice donor site probably null
R8773:Dnah11 UTSW 12 117,958,950 (GRCm39) missense possibly damaging 0.94
R8818:Dnah11 UTSW 12 117,874,764 (GRCm39) missense probably damaging 1.00
R8855:Dnah11 UTSW 12 118,156,107 (GRCm39) missense probably benign 0.03
R8866:Dnah11 UTSW 12 118,156,107 (GRCm39) missense probably benign 0.03
R8881:Dnah11 UTSW 12 118,090,550 (GRCm39) missense probably benign 0.05
R8881:Dnah11 UTSW 12 118,077,647 (GRCm39) missense probably benign 0.00
R8920:Dnah11 UTSW 12 118,077,674 (GRCm39) missense probably damaging 0.99
R8944:Dnah11 UTSW 12 118,091,381 (GRCm39) missense possibly damaging 0.63
R8945:Dnah11 UTSW 12 117,987,718 (GRCm39) missense probably benign 0.36
R8962:Dnah11 UTSW 12 117,918,630 (GRCm39) missense probably damaging 1.00
R8962:Dnah11 UTSW 12 117,916,273 (GRCm39) missense probably damaging 1.00
R9059:Dnah11 UTSW 12 118,094,578 (GRCm39) missense probably benign 0.00
R9155:Dnah11 UTSW 12 117,991,251 (GRCm39) missense probably damaging 0.99
R9162:Dnah11 UTSW 12 117,991,251 (GRCm39) missense probably damaging 0.99
R9164:Dnah11 UTSW 12 117,991,251 (GRCm39) missense probably damaging 0.99
R9171:Dnah11 UTSW 12 117,894,918 (GRCm39) missense probably damaging 0.99
R9186:Dnah11 UTSW 12 118,154,632 (GRCm39) missense probably benign
R9205:Dnah11 UTSW 12 117,991,251 (GRCm39) missense probably damaging 0.99
R9208:Dnah11 UTSW 12 117,991,251 (GRCm39) missense probably damaging 0.99
R9234:Dnah11 UTSW 12 117,951,095 (GRCm39) missense probably damaging 1.00
R9264:Dnah11 UTSW 12 117,991,262 (GRCm39) missense probably damaging 1.00
R9290:Dnah11 UTSW 12 117,991,251 (GRCm39) missense probably damaging 0.99
R9291:Dnah11 UTSW 12 117,991,251 (GRCm39) missense probably damaging 0.99
R9315:Dnah11 UTSW 12 118,143,341 (GRCm39) missense probably benign 0.11
R9353:Dnah11 UTSW 12 118,143,434 (GRCm39) missense probably benign 0.00
R9375:Dnah11 UTSW 12 117,884,703 (GRCm39) missense possibly damaging 0.67
R9392:Dnah11 UTSW 12 118,141,290 (GRCm39) missense probably benign 0.00
R9392:Dnah11 UTSW 12 118,011,055 (GRCm39) nonsense probably null
R9433:Dnah11 UTSW 12 117,976,007 (GRCm39) missense probably damaging 1.00
R9511:Dnah11 UTSW 12 117,878,352 (GRCm39) missense probably damaging 1.00
R9526:Dnah11 UTSW 12 118,150,711 (GRCm39) missense probably damaging 0.98
R9566:Dnah11 UTSW 12 117,938,728 (GRCm39) missense possibly damaging 0.69
R9673:Dnah11 UTSW 12 117,982,513 (GRCm39) missense possibly damaging 0.91
R9705:Dnah11 UTSW 12 118,094,770 (GRCm39) missense probably damaging 1.00
R9716:Dnah11 UTSW 12 118,024,148 (GRCm39) missense probably damaging 0.99
R9746:Dnah11 UTSW 12 117,842,311 (GRCm39) nonsense probably null
R9764:Dnah11 UTSW 12 117,884,704 (GRCm39) missense probably benign 0.05
RF023:Dnah11 UTSW 12 117,918,585 (GRCm39) missense probably damaging 1.00
RF047:Dnah11 UTSW 12 117,973,818 (GRCm39) missense probably damaging 1.00
Z1088:Dnah11 UTSW 12 117,858,747 (GRCm39) missense probably damaging 1.00
Z1088:Dnah11 UTSW 12 117,946,704 (GRCm39) missense probably damaging 1.00
Z1176:Dnah11 UTSW 12 118,094,534 (GRCm39) missense probably damaging 0.97
Z1176:Dnah11 UTSW 12 118,090,854 (GRCm39) missense probably benign 0.00
Z1176:Dnah11 UTSW 12 117,894,912 (GRCm39) missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- CATCTCTCCCTTGGGAATGAGG -3'
(R):5'- ACTGCTGAGCTAGAGTGCAG -3'

Sequencing Primer
(F):5'- CTCCCTTGGGAATGAGGAGTGG -3'
(R):5'- GTGCAGAGTGTCACAGACTC -3'
Posted On 2015-03-25