Incidental Mutation 'R3779:Gm5819'
ID271986
Institutional Source Beutler Lab
Gene Symbol Gm5819
Ensembl Gene ENSMUSG00000092097
Gene Namepredicted gene 5819
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.379) question?
Stock #R3779 (G1)
Quality Score151
Status Validated
Chromosome18
Chromosomal Location8694077-8694541 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 8694429 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 118 (E118G)
Ref Sequence ENSEMBL: ENSMUSP00000127997 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171469]
Predicted Effect probably damaging
Transcript: ENSMUST00000171469
AA Change: E118G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127997
Gene: ENSMUSG00000092097
AA Change: E118G

DomainStartEndE-ValueType
coiled coil region 73 105 N/A INTRINSIC
RING 113 147 4.13e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175601
Meta Mutation Damage Score 0.5502 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 98% (47/48)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310079G19Rik A G 16: 88,627,385 C73R probably damaging Het
Acot10 A G 15: 20,665,542 V371A probably damaging Het
Ambn C A 5: 88,465,342 probably benign Het
Ankrd34a T C 3: 96,598,931 F484L possibly damaging Het
Bcl11a A G 11: 24,164,568 K637R probably damaging Het
Cenpe T C 3: 135,256,576 S1968P possibly damaging Het
Cfap61 T C 2: 145,950,794 I52T probably damaging Het
Cit A T 5: 115,859,341 M128L probably benign Het
Cnga1 G T 5: 72,604,783 L463I probably damaging Het
Dnah11 C T 12: 118,130,713 probably benign Het
Elovl4 ACT A 9: 83,785,148 probably null Het
Ep400 A G 5: 110,691,649 I1853T unknown Het
Flg2 C T 3: 93,202,423 S586L unknown Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably benign Het
Gm21886 G T 18: 80,089,434 Q170K possibly damaging Het
Gm9376 T C 14: 118,267,315 V53A probably benign Het
H2-T3 T C 17: 36,189,682 T90A probably damaging Het
Hif1an A G 19: 44,569,408 D243G probably damaging Het
Hmgcs2 C T 3: 98,299,112 probably benign Het
Ighv1-72 A T 12: 115,758,016 S107T probably damaging Het
Jak1 G A 4: 101,156,490 H1014Y probably benign Het
Klrb1c T C 6: 128,780,343 D253G probably damaging Het
Lpin1 G A 12: 16,564,568 T404M probably damaging Het
Map3k9 A T 12: 81,743,791 probably benign Het
Myl12a G T 17: 70,994,636 H165Q possibly damaging Het
Olfr768 A G 10: 129,093,296 F226S possibly damaging Het
Pdgfrb T A 18: 61,072,666 S575T probably damaging Het
Phldb2 T C 16: 45,748,755 Y1247C probably damaging Het
Pinlyp T A 7: 24,541,835 T181S probably benign Het
Pkn2 A G 3: 142,793,980 V928A possibly damaging Het
Skint5 C T 4: 113,779,040 probably benign Het
Skiv2l2 A T 13: 112,903,392 probably benign Het
Slc24a1 A G 9: 64,948,297 Y443H unknown Het
Sp8 G T 12: 118,849,015 V202L possibly damaging Het
Svil A G 18: 5,090,855 N915S probably damaging Het
Syncrip A C 9: 88,476,939 D172E probably damaging Het
Tex26 T C 5: 149,445,851 I48T probably damaging Het
Trpm6 A C 19: 18,876,039 I1808L possibly damaging Het
Uba2 T C 7: 34,154,646 probably null Het
Vwa8 T A 14: 79,102,322 probably benign Het
Wfs1 C A 5: 36,968,624 V308L probably benign Het
Wrn T A 8: 33,241,020 R1095W probably damaging Het
Zfp808 T A 13: 62,171,903 N315K probably damaging Het
Other mutations in Gm5819
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1863:Gm5819 UTSW 18 8694179 missense probably benign
R3777:Gm5819 UTSW 18 8694429 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGGTTTGAACGGCGTTCC -3'
(R):5'- AGGCAAGTTTCGACACTGTAG -3'

Sequencing Primer
(F):5'- TTCCCGGGAGCATCTGG -3'
(R):5'- ACTGTAGTGGCACGTGGC -3'
Posted On2015-03-25