Incidental Mutation 'R3779:Trpm6'
ID271989
Institutional Source Beutler Lab
Gene Symbol Trpm6
Ensembl Gene ENSMUSG00000024727
Gene Nametransient receptor potential cation channel, subfamily M, member 6
SynonymsCHAK2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3779 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location18749983-18892510 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 18876039 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 1808 (I1808L)
Ref Sequence ENSEMBL: ENSMUSP00000037443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040489]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040489
AA Change: I1808L

PolyPhen 2 Score 0.801 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000037443
Gene: ENSMUSG00000024727
AA Change: I1808L

DomainStartEndE-ValueType
Blast:ANK 430 459 4e-8 BLAST
low complexity region 580 604 N/A INTRINSIC
transmembrane domain 749 766 N/A INTRINSIC
Pfam:Ion_trans 847 1087 2.8e-13 PFAM
low complexity region 1113 1126 N/A INTRINSIC
low complexity region 1136 1154 N/A INTRINSIC
Pfam:TRPM_tetra 1176 1231 7.5e-27 PFAM
low complexity region 1320 1331 N/A INTRINSIC
low complexity region 1578 1596 N/A INTRINSIC
Blast:Alpha_kinase 1618 1673 9e-11 BLAST
low complexity region 1682 1695 N/A INTRINSIC
Alpha_kinase 1761 1978 1e-84 SMART
Meta Mutation Damage Score 0.2731 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is predominantly expressed in the kidney and colon, and encodes a protein containing an ion channel domain and a protein kinase domain. It is crucial for magnesium homeostasis, and plays an essential role in epithelial magnesium transport and in the active magnesium absorption in the gut and kidney. Mutations in this gene are associated with hypomagnesemia with secondary hypocalcemia. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic and postnatal lethality with exencephaly, spina bifida occulta, and abnormal brain and facial development. Mice heterozygous for a knock-out allele exhibit some premature death and decreased serummagnesium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310079G19Rik A G 16: 88,627,385 C73R probably damaging Het
Acot10 A G 15: 20,665,542 V371A probably damaging Het
Ambn C A 5: 88,465,342 probably benign Het
Ankrd34a T C 3: 96,598,931 F484L possibly damaging Het
Bcl11a A G 11: 24,164,568 K637R probably damaging Het
Cenpe T C 3: 135,256,576 S1968P possibly damaging Het
Cfap61 T C 2: 145,950,794 I52T probably damaging Het
Cit A T 5: 115,859,341 M128L probably benign Het
Cnga1 G T 5: 72,604,783 L463I probably damaging Het
Dnah11 C T 12: 118,130,713 probably benign Het
Elovl4 ACT A 9: 83,785,148 probably null Het
Ep400 A G 5: 110,691,649 I1853T unknown Het
Flg2 C T 3: 93,202,423 S586L unknown Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably benign Het
Gm21886 G T 18: 80,089,434 Q170K possibly damaging Het
Gm5819 A G 18: 8,694,429 E118G probably damaging Het
Gm9376 T C 14: 118,267,315 V53A probably benign Het
H2-T3 T C 17: 36,189,682 T90A probably damaging Het
Hif1an A G 19: 44,569,408 D243G probably damaging Het
Hmgcs2 C T 3: 98,299,112 probably benign Het
Ighv1-72 A T 12: 115,758,016 S107T probably damaging Het
Jak1 G A 4: 101,156,490 H1014Y probably benign Het
Klrb1c T C 6: 128,780,343 D253G probably damaging Het
Lpin1 G A 12: 16,564,568 T404M probably damaging Het
Map3k9 A T 12: 81,743,791 probably benign Het
Myl12a G T 17: 70,994,636 H165Q possibly damaging Het
Olfr768 A G 10: 129,093,296 F226S possibly damaging Het
Pdgfrb T A 18: 61,072,666 S575T probably damaging Het
Phldb2 T C 16: 45,748,755 Y1247C probably damaging Het
Pinlyp T A 7: 24,541,835 T181S probably benign Het
Pkn2 A G 3: 142,793,980 V928A possibly damaging Het
Skint5 C T 4: 113,779,040 probably benign Het
Skiv2l2 A T 13: 112,903,392 probably benign Het
Slc24a1 A G 9: 64,948,297 Y443H unknown Het
Sp8 G T 12: 118,849,015 V202L possibly damaging Het
Svil A G 18: 5,090,855 N915S probably damaging Het
Syncrip A C 9: 88,476,939 D172E probably damaging Het
Tex26 T C 5: 149,445,851 I48T probably damaging Het
Uba2 T C 7: 34,154,646 probably null Het
Vwa8 T A 14: 79,102,322 probably benign Het
Wfs1 C A 5: 36,968,624 V308L probably benign Het
Wrn T A 8: 33,241,020 R1095W probably damaging Het
Zfp808 T A 13: 62,171,903 N315K probably damaging Het
Other mutations in Trpm6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Trpm6 APN 19 18783908 splice site probably benign
IGL00862:Trpm6 APN 19 18827528 missense probably damaging 1.00
IGL01348:Trpm6 APN 19 18877651 missense probably damaging 1.00
IGL01400:Trpm6 APN 19 18825794 nonsense probably null
IGL01451:Trpm6 APN 19 18809569 missense probably damaging 1.00
IGL01508:Trpm6 APN 19 18796530 nonsense probably null
IGL01995:Trpm6 APN 19 18830327 splice site probably benign
IGL02092:Trpm6 APN 19 18772331 missense possibly damaging 0.59
IGL02152:Trpm6 APN 19 18832539 missense possibly damaging 0.93
IGL02294:Trpm6 APN 19 18854063 missense probably benign
IGL02329:Trpm6 APN 19 18854217 missense probably benign 0.17
IGL02366:Trpm6 APN 19 18778510 splice site probably benign
IGL02402:Trpm6 APN 19 18786756 missense probably benign 0.18
IGL02457:Trpm6 APN 19 18825791 missense probably damaging 1.00
IGL02457:Trpm6 APN 19 18827398 nonsense probably null
IGL02684:Trpm6 APN 19 18802207 splice site probably benign
IGL02705:Trpm6 APN 19 18776733 critical splice donor site probably null
IGL02728:Trpm6 APN 19 18809652 missense possibly damaging 0.71
IGL02742:Trpm6 APN 19 18830012 splice site probably benign
IGL02818:Trpm6 APN 19 18866257 missense probably benign 0.04
IGL02836:Trpm6 APN 19 18813482 missense probably damaging 1.00
IGL03119:Trpm6 APN 19 18838017 nonsense probably null
IGL03193:Trpm6 APN 19 18825872 missense possibly damaging 0.94
IGL03227:Trpm6 APN 19 18819119 missense probably benign 0.01
IGL03227:Trpm6 APN 19 18786779 missense probably benign 0.12
IGL03231:Trpm6 APN 19 18819181 missense probably benign
IGL03245:Trpm6 APN 19 18877701 missense probably damaging 1.00
IGL03328:Trpm6 APN 19 18838082 missense possibly damaging 0.94
IGL03341:Trpm6 APN 19 18813486 missense probably benign
P0043:Trpm6 UTSW 19 18877765 missense probably damaging 1.00
PIT4260001:Trpm6 UTSW 19 18825802 missense possibly damaging 0.48
R0057:Trpm6 UTSW 19 18786755 missense probably benign 0.05
R0115:Trpm6 UTSW 19 18829952 missense probably damaging 0.98
R0119:Trpm6 UTSW 19 18832593 missense probably benign 0.05
R0140:Trpm6 UTSW 19 18819194 splice site probably null
R0267:Trpm6 UTSW 19 18823378 missense probably benign
R0350:Trpm6 UTSW 19 18883957 splice site probably null
R0373:Trpm6 UTSW 19 18853587 missense probably benign 0.15
R0393:Trpm6 UTSW 19 18778644 missense probably damaging 0.99
R0416:Trpm6 UTSW 19 18783025 splice site probably benign
R0505:Trpm6 UTSW 19 18873902 splice site probably benign
R0526:Trpm6 UTSW 19 18792876 missense probably damaging 0.97
R0607:Trpm6 UTSW 19 18872221 missense probably benign 0.00
R0609:Trpm6 UTSW 19 18825862 missense probably damaging 0.97
R0714:Trpm6 UTSW 19 18838087 missense possibly damaging 0.90
R1215:Trpm6 UTSW 19 18796498 missense probably damaging 1.00
R1474:Trpm6 UTSW 19 18796495 missense probably benign 0.28
R1512:Trpm6 UTSW 19 18875931 missense probably benign
R1558:Trpm6 UTSW 19 18786828 missense probably benign 0.04
R1597:Trpm6 UTSW 19 18827524 missense probably damaging 0.98
R1618:Trpm6 UTSW 19 18877631 missense possibly damaging 0.88
R1779:Trpm6 UTSW 19 18856217 missense probably damaging 1.00
R1796:Trpm6 UTSW 19 18827567 missense possibly damaging 0.90
R1799:Trpm6 UTSW 19 18891999 splice site probably null
R1840:Trpm6 UTSW 19 18866267 missense probably benign 0.21
R1991:Trpm6 UTSW 19 18796284 missense probably benign 0.00
R2030:Trpm6 UTSW 19 18854265 missense probably benign
R2073:Trpm6 UTSW 19 18876042 missense probably damaging 1.00
R2074:Trpm6 UTSW 19 18877739 missense probably damaging 1.00
R2096:Trpm6 UTSW 19 18825752 missense probably damaging 0.97
R2103:Trpm6 UTSW 19 18796284 missense probably benign 0.00
R2106:Trpm6 UTSW 19 18813350 missense possibly damaging 0.95
R2117:Trpm6 UTSW 19 18829952 missense probably damaging 0.98
R2850:Trpm6 UTSW 19 18792090 missense possibly damaging 0.68
R3125:Trpm6 UTSW 19 18854431 missense probably benign 0.05
R3719:Trpm6 UTSW 19 18772393 nonsense probably null
R4115:Trpm6 UTSW 19 18832557 missense probably damaging 1.00
R4367:Trpm6 UTSW 19 18827525 missense probably damaging 0.99
R4523:Trpm6 UTSW 19 18796500 missense probably damaging 1.00
R4546:Trpm6 UTSW 19 18832477 missense probably damaging 1.00
R4564:Trpm6 UTSW 19 18832597 missense possibly damaging 0.95
R4565:Trpm6 UTSW 19 18825872 missense probably damaging 1.00
R4697:Trpm6 UTSW 19 18853791 missense probably benign 0.01
R4714:Trpm6 UTSW 19 18854200 missense possibly damaging 0.93
R4750:Trpm6 UTSW 19 18876064 missense probably damaging 0.99
R4771:Trpm6 UTSW 19 18813493 missense probably damaging 0.97
R4791:Trpm6 UTSW 19 18867981 missense probably benign 0.00
R4814:Trpm6 UTSW 19 18862212 missense probably benign 0.11
R5028:Trpm6 UTSW 19 18786760 missense probably damaging 1.00
R5237:Trpm6 UTSW 19 18813464 missense probably damaging 1.00
R5615:Trpm6 UTSW 19 18829933 missense probably damaging 0.96
R5642:Trpm6 UTSW 19 18830207 missense probably damaging 1.00
R5645:Trpm6 UTSW 19 18853604 missense probably damaging 1.00
R5726:Trpm6 UTSW 19 18853617 missense probably damaging 1.00
R5832:Trpm6 UTSW 19 18786819 missense possibly damaging 0.66
R5843:Trpm6 UTSW 19 18856175 missense probably benign 0.04
R5955:Trpm6 UTSW 19 18892019 missense possibly damaging 0.75
R6101:Trpm6 UTSW 19 18853748 nonsense probably null
R6105:Trpm6 UTSW 19 18853748 nonsense probably null
R6211:Trpm6 UTSW 19 18783128 missense probably damaging 1.00
R6228:Trpm6 UTSW 19 18854291 missense probably damaging 1.00
R6263:Trpm6 UTSW 19 18854108 missense possibly damaging 0.94
R6453:Trpm6 UTSW 19 18829990 missense probably damaging 1.00
R6562:Trpm6 UTSW 19 18838042 missense probably damaging 1.00
R6624:Trpm6 UTSW 19 18796439 critical splice acceptor site probably null
R6624:Trpm6 UTSW 19 18889020 missense probably damaging 1.00
R6729:Trpm6 UTSW 19 18830297 missense probably damaging 1.00
R6765:Trpm6 UTSW 19 18877765 missense probably damaging 1.00
R6976:Trpm6 UTSW 19 18783163 missense probably benign
R7103:Trpm6 UTSW 19 18813547 missense possibly damaging 0.87
R7126:Trpm6 UTSW 19 18854033 nonsense probably null
R7128:Trpm6 UTSW 19 18811773 missense possibly damaging 0.92
R7157:Trpm6 UTSW 19 18838098 missense possibly damaging 0.91
R7212:Trpm6 UTSW 19 18853791 missense probably benign 0.01
R7263:Trpm6 UTSW 19 18876786 missense probably damaging 1.00
R7268:Trpm6 UTSW 19 18778585 missense probably benign 0.13
R7305:Trpm6 UTSW 19 18876091 missense probably benign 0.30
R7498:Trpm6 UTSW 19 18876120 missense probably damaging 1.00
R7558:Trpm6 UTSW 19 18778665 missense probably damaging 0.96
R7590:Trpm6 UTSW 19 18832581 missense probably benign 0.31
R7646:Trpm6 UTSW 19 18867961 missense probably benign 0.10
R7650:Trpm6 UTSW 19 18876013 missense possibly damaging 0.70
R7727:Trpm6 UTSW 19 18854249
Predicted Primers PCR Primer
(F):5'- AAGTTCTCCTCTGACCCTGG -3'
(R):5'- AGGTTTCTAGACTGCCCAAC -3'

Sequencing Primer
(F):5'- TCTGACCCTGGATAAGAGCATGTC -3'
(R):5'- GACTCTTTTTCAGTTGAGGAAAATCC -3'
Posted On2015-03-25