Incidental Mutation 'R3780:Npepl1'
ID271994
Institutional Source Beutler Lab
Gene Symbol Npepl1
Ensembl Gene ENSMUSG00000039263
Gene Nameaminopeptidase-like 1
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.221) question?
Stock #R3780 (G1)
Quality Score206
Status Validated
Chromosome2
Chromosomal Location174110349-174123070 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 174120654 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 371 (L371R)
Ref Sequence ENSEMBL: ENSMUSP00000042808 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044415]
Predicted Effect probably damaging
Transcript: ENSMUST00000044415
AA Change: L371R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042808
Gene: ENSMUSG00000039263
AA Change: L371R

DomainStartEndE-ValueType
low complexity region 22 32 N/A INTRINSIC
Pfam:Peptidase_M17 179 484 1.9e-98 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125502
SMART Domains Protein: ENSMUSP00000133202
Gene: ENSMUSG00000039263

DomainStartEndE-ValueType
Pfam:Peptidase_M17 104 207 4.4e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131346
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136449
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153957
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166709
Meta Mutation Damage Score 0.9688 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 93% (40/43)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik G T 7: 29,560,838 noncoding transcript Het
Adam21 C T 12: 81,559,273 V572I probably damaging Het
Arhgap32 T A 9: 32,152,019 probably null Het
Carmil1 A T 13: 24,137,169 I281N probably damaging Het
Cdh12 T A 15: 21,585,977 probably null Het
Cdh7 T A 1: 110,049,004 V133E probably benign Het
Cntrob A G 11: 69,302,882 L814P probably damaging Het
Csmd1 T C 8: 16,201,986 N952S probably damaging Het
Cspg4 A G 9: 56,888,233 Y1084C probably damaging Het
Dlg5 A G 14: 24,190,310 probably benign Het
Glis2 T C 16: 4,613,896 probably benign Het
Hif3a T C 7: 17,054,713 E111G probably damaging Het
Kctd4 A G 14: 75,962,811 D74G probably benign Het
Kif21b A T 1: 136,156,226 K737M probably damaging Het
Ktn1 G A 14: 47,706,403 probably benign Het
Lama2 A T 10: 27,459,339 N113K probably damaging Het
Ltv1 A G 10: 13,179,200 S409P probably benign Het
Mgat4c A G 10: 102,388,921 E332G probably benign Het
Myh6 A G 14: 54,963,958 F95L probably benign Het
Ndufa4l2 A G 10: 127,515,420 I27V probably benign Het
Nudt9 A G 5: 104,047,106 T23A probably benign Het
Ocrl G A X: 47,938,303 V416I probably benign Het
Olfr123 T G 17: 37,796,004 C187G probably damaging Het
Padi2 C T 4: 140,917,737 T94I probably benign Het
Pcca G A 14: 122,684,885 E353K probably damaging Het
Pcdhgb2 T A 18: 37,691,757 N600K probably damaging Het
Pex5l A G 3: 32,950,844 L593P probably damaging Het
Rbp2 G A 9: 98,498,826 D62N probably benign Het
Rock1 G T 18: 10,067,575 N1319K probably benign Het
Ror1 A C 4: 100,412,117 D384A probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Sacm1l A T 9: 123,552,790 E152D probably benign Het
Seh1l T C 18: 67,775,017 V3A probably benign Het
Serpinb6d T A 13: 33,664,114 D20E probably benign Het
Serpini1 T G 3: 75,614,635 N144K probably damaging Het
Slc22a23 G A 13: 34,344,340 T153I probably benign Het
Slfn8 A G 11: 83,017,454 S88P probably benign Het
Stpg3 T A 2: 25,213,863 M154L probably benign Het
Vmn2r115 G A 17: 23,345,172 C106Y probably damaging Het
Washc3 C T 10: 88,219,260 T112M probably benign Het
Zfp280d C T 9: 72,322,524 T346M probably damaging Het
Other mutations in Npepl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Npepl1 APN 2 174120548 missense probably damaging 1.00
IGL01651:Npepl1 APN 2 174114388 splice site probably benign
IGL01998:Npepl1 APN 2 174116200 splice site probably benign
IGL02079:Npepl1 APN 2 174119390 intron probably benign
R0081:Npepl1 UTSW 2 174116086 missense probably damaging 1.00
R1236:Npepl1 UTSW 2 174114480 critical splice donor site probably null
R2350:Npepl1 UTSW 2 174111773 missense probably benign
R3950:Npepl1 UTSW 2 174121113 missense probably damaging 1.00
R4688:Npepl1 UTSW 2 174114442 missense possibly damaging 0.78
R5650:Npepl1 UTSW 2 174121536 missense possibly damaging 0.83
R5916:Npepl1 UTSW 2 174121544 missense probably benign 0.01
R6007:Npepl1 UTSW 2 174121057 missense probably benign 0.03
R6487:Npepl1 UTSW 2 174111732 missense probably benign 0.16
R7267:Npepl1 UTSW 2 174122116 missense probably damaging 1.00
R7881:Npepl1 UTSW 2 174120594 missense probably damaging 1.00
R8103:Npepl1 UTSW 2 174111209 missense probably benign 0.00
Z1177:Npepl1 UTSW 2 174122130 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGTCAGCGATGCTCAGTTG -3'
(R):5'- GGTACTTCCCTGTGGCAATG -3'

Sequencing Primer
(F):5'- CTCAGTTGGAGCTGTATTCCTGAAC -3'
(R):5'- CCGTACCAGGGAAGACAGC -3'
Posted On2015-03-25