Mutagenetix > Incidental Mutations

Incidental Mutation 'R3780:Ror1'

271997

Institutional Source

Beutler Lab

Gene Symbol

Ror1

Ensembl Gene

ENSMUSG00000035305

Gene Name

receptor tyrosine kinase-like orphan receptor 1

Synonyms

2810404D04Rik, Ntrkr1

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R3780 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

100095791-100444765 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 100412117 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Alanine at position 384 (D384A)

Ref Sequence

ENSEMBL: ENSMUSP00000048171 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039630]

Predicted Effect

probably benign
Transcript: ENSMUST00000039630
AA Change: D384A

PolyPhen 2 Score 0.337 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000048171
Gene: ENSMUSG00000035305
AA Change: D384A

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
IGc2	70	138	8.37e-15	SMART
Pfam:Fz	170	290	4.9e-13	PFAM
KR	311	393	7.57e-47	SMART
transmembrane domain	404	426	N/A	INTRINSIC
TyrKc	473	746	2.46e-137	SMART
low complexity region	753	762	N/A	INTRINSIC
low complexity region	817	828	N/A	INTRINSIC
low complexity region	849	864	N/A	INTRINSIC

Meta Mutation Damage Score

0.7132

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.9%

Validation Efficiency

93% (40/43)

MGI Phenotype

FUNCTION: This gene encodes a receptor tyrosine kinase that has been implicated in nervous system development, specifically in the maintenance of neural progenitor cell fate, neurite extension and synapse formation. The encoded protein, likely a pseudokinase that lacks catalytic activity, may also regulate adipogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for some disruptions in this gene die within the first day after birth from respiratory defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930432E11Rik	G	T	7: 29,560,838		noncoding transcript	Het
Adam21	C	T	12: 81,559,273	V572I	probably damaging	Het
Arhgap32	T	A	9: 32,152,019		probably null	Het
Carmil1	A	T	13: 24,137,169	I281N	probably damaging	Het
Cdh12	T	A	15: 21,585,977		probably null	Het
Cdh7	T	A	1: 110,049,004	V133E	probably benign	Het
Cntrob	A	G	11: 69,302,882	L814P	probably damaging	Het
Csmd1	T	C	8: 16,201,986	N952S	probably damaging	Het
Cspg4	A	G	9: 56,888,233	Y1084C	probably damaging	Het
Dlg5	A	G	14: 24,190,310		probably benign	Het
Glis2	T	C	16: 4,613,896		probably benign	Het
Hif3a	T	C	7: 17,054,713	E111G	probably damaging	Het
Kctd4	A	G	14: 75,962,811	D74G	probably benign	Het
Kif21b	A	T	1: 136,156,226	K737M	probably damaging	Het
Ktn1	G	A	14: 47,706,403		probably benign	Het
Lama2	A	T	10: 27,459,339	N113K	probably damaging	Het
Ltv1	A	G	10: 13,179,200	S409P	probably benign	Het
Mgat4c	A	G	10: 102,388,921	E332G	probably benign	Het
Myh6	A	G	14: 54,963,958	F95L	probably benign	Het
Ndufa4l2	A	G	10: 127,515,420	I27V	probably benign	Het
Npepl1	T	G	2: 174,120,654	L371R	probably damaging	Het
Nudt9	A	G	5: 104,047,106	T23A	probably benign	Het
Ocrl	G	A	X: 47,938,303	V416I	probably benign	Het
Olfr123	T	G	17: 37,796,004	C187G	probably damaging	Het
Padi2	C	T	4: 140,917,737	T94I	probably benign	Het
Pcca	G	A	14: 122,684,885	E353K	probably damaging	Het
Pcdhgb2	T	A	18: 37,691,757	N600K	probably damaging	Het
Pex5l	A	G	3: 32,950,844	L593P	probably damaging	Het
Rbp2	G	A	9: 98,498,826	D62N	probably benign	Het
Rock1	G	T	18: 10,067,575	N1319K	probably benign	Het
Rsf1	ATGGCG	ATGGCGACGGTGGCG	7: 97,579,904		probably benign	Het
Sacm1l	A	T	9: 123,552,790	E152D	probably benign	Het
Seh1l	T	C	18: 67,775,017	V3A	probably benign	Het
Serpinb6d	T	A	13: 33,664,114	D20E	probably benign	Het
Serpini1	T	G	3: 75,614,635	N144K	probably damaging	Het
Slc22a23	G	A	13: 34,344,340	T153I	probably benign	Het
Slfn8	A	G	11: 83,017,454	S88P	probably benign	Het
Stpg3	T	A	2: 25,213,863	M154L	probably benign	Het
Vmn2r115	G	A	17: 23,345,172	C106Y	probably damaging	Het
Washc3	C	T	10: 88,219,260	T112M	probably benign	Het
Zfp280d	C	T	9: 72,322,524	T346M	probably damaging	Het

Other mutations in Ror1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00838:Ror1	APN	4	100333743	missense	probably damaging	1.00
IGL00939:Ror1	APN	4	100441226	missense	probably benign	0.01
IGL01408:Ror1	APN	4	100333787	missense	probably damaging	1.00
IGL01678:Ror1	APN	4	100425968	missense	possibly damaging	0.68
IGL01700:Ror1	APN	4	100409771	missense	probably damaging	1.00
IGL01985:Ror1	APN	4	100425964	missense	possibly damaging	0.94
IGL02002:Ror1	APN	4	100441184	missense	probably damaging	1.00
IGL02634:Ror1	APN	4	100426110	missense	probably benign	0.00
IGL02995:Ror1	APN	4	100334525	splice site	probably benign
IGL03033:Ror1	APN	4	100411895	missense	possibly damaging	0.67
IGL03207:Ror1	APN	4	100407945	splice site	probably null
F5770:Ror1	UTSW	4	100440933	missense	probably damaging	0.99
R0256:Ror1	UTSW	4	100409745	missense	probably benign	0.20
R0417:Ror1	UTSW	4	100412000	missense	possibly damaging	0.94
R0525:Ror1	UTSW	4	100441520	missense	probably damaging	1.00
R1034:Ror1	UTSW	4	100333620	nonsense	probably null
R1278:Ror1	UTSW	4	100441878	missense	possibly damaging	0.69
R1368:Ror1	UTSW	4	100441137	missense	possibly damaging	0.94
R1437:Ror1	UTSW	4	100412109	missense	probably benign
R1441:Ror1	UTSW	4	100440983	missense	probably benign
R1544:Ror1	UTSW	4	100441986	missense	probably damaging	1.00
R1717:Ror1	UTSW	4	100302938	missense	probably benign
R1857:Ror1	UTSW	4	100441503	missense	probably damaging	1.00
R2018:Ror1	UTSW	4	100407841	nonsense	probably null
R2051:Ror1	UTSW	4	100407868	nonsense	probably null
R2127:Ror1	UTSW	4	100442093	missense	probably benign
R2132:Ror1	UTSW	4	100410025	missense	probably benign	0.35
R2133:Ror1	UTSW	4	100410025	missense	probably benign	0.35
R2176:Ror1	UTSW	4	100441874	missense	probably damaging	0.99
R2431:Ror1	UTSW	4	100441155	missense	probably damaging	1.00
R2896:Ror1	UTSW	4	100096280	missense	unknown
R3005:Ror1	UTSW	4	100441764	missense	probably damaging	0.99
R3850:Ror1	UTSW	4	100442160	missense	possibly damaging	0.90
R3861:Ror1	UTSW	4	100407923	missense	possibly damaging	0.46
R4599:Ror1	UTSW	4	100407910	missense	probably damaging	0.99
R4863:Ror1	UTSW	4	100409804	missense	probably damaging	0.99
R4871:Ror1	UTSW	4	100425998	missense	probably benign
R4990:Ror1	UTSW	4	100441964	missense	probably benign
R5023:Ror1	UTSW	4	100425932	missense	probably benign	0.01
R5028:Ror1	UTSW	4	100411936	missense	possibly damaging	0.67
R5079:Ror1	UTSW	4	100441422	missense	probably damaging	1.00
R5294:Ror1	UTSW	4	100425938	missense	probably benign	0.00
R5538:Ror1	UTSW	4	100441011	missense	probably benign
R6339:Ror1	UTSW	4	100411931	missense	possibly damaging	0.91
R6491:Ror1	UTSW	4	100409912	missense	possibly damaging	0.94
R6632:Ror1	UTSW	4	100442106	missense	probably benign
R6733:Ror1	UTSW	4	100426055	missense	probably benign
R7022:Ror1	UTSW	4	100407911	missense	probably damaging	1.00
R7054:Ror1	UTSW	4	100442239	missense	probably benign	0.00
R7121:Ror1	UTSW	4	100302945	missense	probably benign	0.00
R7350:Ror1	UTSW	4	100425943	missense	probably benign	0.00
R7492:Ror1	UTSW	4	100441059	missense	probably benign	0.22
R7502:Ror1	UTSW	4	100333630	missense	probably benign	0.03
R7531:Ror1	UTSW	4	100441191	missense	probably damaging	1.00
R7661:Ror1	UTSW	4	100441490	missense	probably damaging	1.00
R7822:Ror1	UTSW	4	100441367	missense	probably damaging	1.00
R7831:Ror1	UTSW	4	100441098	missense	probably benign	0.01
R8366:Ror1	UTSW	4	100409998	missense	possibly damaging	0.91
R8539:Ror1	UTSW	4	100441887	missense	possibly damaging	0.71
R8757:Ror1	UTSW	4	100440883	missense	probably benign	0.01
R8862:Ror1	UTSW	4	100334518	critical splice donor site	probably null
R8913:Ror1	UTSW	4	100407830	missense	possibly damaging	0.89
V7580:Ror1	UTSW	4	100440933	missense	probably damaging	0.99
V7583:Ror1	UTSW	4	100440933	missense	probably damaging	0.99
X0020:Ror1	UTSW	4	100426090	missense	probably benign	0.02
Z1177:Ror1	UTSW	4	100302919	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ACCGTCAGTGTGACCAAGTC -3'
(R):5'- AGTGACTACAGGTGCTCCTTG -3'

Sequencing Primer
(F):5'- TCAGTGTGACCAAGTCTGGAC -3'
(R):5'- TCCTTGAGGGAGGCACTG -3'

Posted On

2015-03-25