Incidental Mutation 'R3780:Rbp2'
ID272008
Institutional Source Beutler Lab
Gene Symbol Rbp2
Ensembl Gene ENSMUSG00000032454
Gene Nameretinol binding protein 2, cellular
SynonymsRbp-2, CrbpII, Crbp-2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R3780 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location98486115-98509781 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 98498826 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 62 (D62N)
Ref Sequence ENSEMBL: ENSMUSP00000140676 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035029] [ENSMUST00000187905] [ENSMUST00000189446]
Predicted Effect probably benign
Transcript: ENSMUST00000035029
AA Change: D62N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000035029
Gene: ENSMUSG00000032454
AA Change: D62N

DomainStartEndE-ValueType
Pfam:Lipocalin_7 4 134 4.2e-11 PFAM
Pfam:Lipocalin 6 134 4.3e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000187905
AA Change: D62N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000140630
Gene: ENSMUSG00000032454
AA Change: D62N

DomainStartEndE-ValueType
Pfam:Lipocalin_7 4 134 4.2e-11 PFAM
Pfam:Lipocalin 6 134 4.3e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188779
Predicted Effect probably benign
Transcript: ENSMUST00000189446
AA Change: D62N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000140676
Gene: ENSMUSG00000032454
AA Change: D62N

DomainStartEndE-ValueType
Pfam:Lipocalin_7 4 134 4.2e-11 PFAM
Pfam:Lipocalin 6 134 4.3e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195675
Meta Mutation Damage Score 0.0953 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 93% (40/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an abundant protein present in the small intestinal epithelium. It is thought to participate in the uptake and/or intracellular metabolism of vitamin A. Vitamin A is a fat-soluble vitamin necessary for growth, reproduction, differentiation of epithelial tissues, and vision. This protein may also modulate the supply of retinoic acid to the nuclei of endometrial cells during the menstrual cycle. [provided by RefSeq, Aug 2015]
PHENOTYPE: Saturable vitamin A (retinol) uptake is impaired in homozygous mutant mice. Serum retinol levels are unaffected when with normal dietary intake, however, pups of homozygous dams fed a marginal retinol diet show increased neonatal lethality due to inadequate retinal transport to the fetus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik G T 7: 29,560,838 noncoding transcript Het
Adam21 C T 12: 81,559,273 V572I probably damaging Het
Arhgap32 T A 9: 32,152,019 probably null Het
Carmil1 A T 13: 24,137,169 I281N probably damaging Het
Cdh12 T A 15: 21,585,977 probably null Het
Cdh7 T A 1: 110,049,004 V133E probably benign Het
Cntrob A G 11: 69,302,882 L814P probably damaging Het
Csmd1 T C 8: 16,201,986 N952S probably damaging Het
Cspg4 A G 9: 56,888,233 Y1084C probably damaging Het
Dlg5 A G 14: 24,190,310 probably benign Het
Glis2 T C 16: 4,613,896 probably benign Het
Hif3a T C 7: 17,054,713 E111G probably damaging Het
Kctd4 A G 14: 75,962,811 D74G probably benign Het
Kif21b A T 1: 136,156,226 K737M probably damaging Het
Ktn1 G A 14: 47,706,403 probably benign Het
Lama2 A T 10: 27,459,339 N113K probably damaging Het
Ltv1 A G 10: 13,179,200 S409P probably benign Het
Mgat4c A G 10: 102,388,921 E332G probably benign Het
Myh6 A G 14: 54,963,958 F95L probably benign Het
Ndufa4l2 A G 10: 127,515,420 I27V probably benign Het
Npepl1 T G 2: 174,120,654 L371R probably damaging Het
Nudt9 A G 5: 104,047,106 T23A probably benign Het
Ocrl G A X: 47,938,303 V416I probably benign Het
Olfr123 T G 17: 37,796,004 C187G probably damaging Het
Padi2 C T 4: 140,917,737 T94I probably benign Het
Pcca G A 14: 122,684,885 E353K probably damaging Het
Pcdhgb2 T A 18: 37,691,757 N600K probably damaging Het
Pex5l A G 3: 32,950,844 L593P probably damaging Het
Rock1 G T 18: 10,067,575 N1319K probably benign Het
Ror1 A C 4: 100,412,117 D384A probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Sacm1l A T 9: 123,552,790 E152D probably benign Het
Seh1l T C 18: 67,775,017 V3A probably benign Het
Serpinb6d T A 13: 33,664,114 D20E probably benign Het
Serpini1 T G 3: 75,614,635 N144K probably damaging Het
Slc22a23 G A 13: 34,344,340 T153I probably benign Het
Slfn8 A G 11: 83,017,454 S88P probably benign Het
Stpg3 T A 2: 25,213,863 M154L probably benign Het
Vmn2r115 G A 17: 23,345,172 C106Y probably damaging Het
Washc3 C T 10: 88,219,260 T112M probably benign Het
Zfp280d C T 9: 72,322,524 T346M probably damaging Het
Other mutations in Rbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Rbp2 APN 9 98498897 splice site probably null
R4835:Rbp2 UTSW 9 98507823 missense probably damaging 0.99
R4980:Rbp2 UTSW 9 98498841 missense probably benign 0.01
R6253:Rbp2 UTSW 9 98490647 missense probably benign 0.02
R6254:Rbp2 UTSW 9 98490647 missense probably benign 0.02
R6312:Rbp2 UTSW 9 98490647 missense probably benign 0.02
R6394:Rbp2 UTSW 9 98507820 missense possibly damaging 0.91
R6819:Rbp2 UTSW 9 98509561 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GAAATGAATGAGTCTGGCTGC -3'
(R):5'- ATTTCTCACATGATCTGAGGCC -3'

Sequencing Primer
(F):5'- GAATGAGTCTGGCTGCACACATC -3'
(R):5'- ATGATCTGAGGCCCCTGCTC -3'
Posted On2015-03-25