Incidental Mutation 'R3780:Cntrob'
ID 272016
Institutional Source Beutler Lab
Gene Symbol Cntrob
Ensembl Gene ENSMUSG00000032782
Gene Name centrobin, centrosomal BRCA2 interacting protein
Synonyms Nip2, 9830165K03Rik, Lip8
Accession Numbers
Essential gene? Probably non essential (E-score: 0.175) question?
Stock # R3780 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 69190313-69214601 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 69193708 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 814 (L814P)
Ref Sequence ENSEMBL: ENSMUSP00000090651 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092973] [ENSMUST00000123176] [ENSMUST00000130780]
AlphaFold Q8CB62
Predicted Effect probably damaging
Transcript: ENSMUST00000092973
AA Change: L814P

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000090651
Gene: ENSMUSG00000032782
AA Change: L814P

DomainStartEndE-ValueType
coiled coil region 191 218 N/A INTRINSIC
coiled coil region 249 557 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123176
Predicted Effect probably benign
Transcript: ENSMUST00000130780
SMART Domains Protein: ENSMUSP00000134842
Gene: ENSMUSG00000032782

DomainStartEndE-ValueType
low complexity region 50 64 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156175
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156671
Predicted Effect probably benign
Transcript: ENSMUST00000176938
Meta Mutation Damage Score 0.5068 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 93% (40/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a centrosomal protein that interacts with BRCA2, and is required for centriole duplication and cytokinesis. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik G T 7: 29,260,263 (GRCm39) noncoding transcript Het
Adam21 C T 12: 81,606,047 (GRCm39) V572I probably damaging Het
Arhgap32 T A 9: 32,063,315 (GRCm39) probably null Het
Carmil1 A T 13: 24,321,152 (GRCm39) I281N probably damaging Het
Cdh12 T A 15: 21,586,063 (GRCm39) probably null Het
Cdh20 T A 1: 109,976,734 (GRCm39) V133E probably benign Het
Csmd1 T C 8: 16,252,000 (GRCm39) N952S probably damaging Het
Cspg4 A G 9: 56,795,517 (GRCm39) Y1084C probably damaging Het
Dlg5 A G 14: 24,240,378 (GRCm39) probably benign Het
Glis2 T C 16: 4,431,760 (GRCm39) probably benign Het
Hif3a T C 7: 16,788,638 (GRCm39) E111G probably damaging Het
Kctd4 A G 14: 76,200,251 (GRCm39) D74G probably benign Het
Kif21b A T 1: 136,083,964 (GRCm39) K737M probably damaging Het
Ktn1 G A 14: 47,943,860 (GRCm39) probably benign Het
Lama2 A T 10: 27,335,335 (GRCm39) N113K probably damaging Het
Ltv1 A G 10: 13,054,944 (GRCm39) S409P probably benign Het
Mgat4c A G 10: 102,224,782 (GRCm39) E332G probably benign Het
Myh6 A G 14: 55,201,415 (GRCm39) F95L probably benign Het
Ndufa4l2 A G 10: 127,351,289 (GRCm39) I27V probably benign Het
Npepl1 T G 2: 173,962,447 (GRCm39) L371R probably damaging Het
Nudt9 A G 5: 104,194,972 (GRCm39) T23A probably benign Het
Ocrl G A X: 47,027,180 (GRCm39) V416I probably benign Het
Or2g1 T G 17: 38,106,895 (GRCm39) C187G probably damaging Het
Padi2 C T 4: 140,645,048 (GRCm39) T94I probably benign Het
Pcca G A 14: 122,922,297 (GRCm39) E353K probably damaging Het
Pcdhgb2 T A 18: 37,824,810 (GRCm39) N600K probably damaging Het
Pex5l A G 3: 33,004,993 (GRCm39) L593P probably damaging Het
Rbp2 G A 9: 98,380,879 (GRCm39) D62N probably benign Het
Rock1 G T 18: 10,067,575 (GRCm39) N1319K probably benign Het
Ror1 A C 4: 100,269,314 (GRCm39) D384A probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,229,111 (GRCm39) probably benign Het
Sacm1l A T 9: 123,381,855 (GRCm39) E152D probably benign Het
Seh1l T C 18: 67,908,087 (GRCm39) V3A probably benign Het
Serpinb6d T A 13: 33,848,097 (GRCm39) D20E probably benign Het
Serpini1 T G 3: 75,521,942 (GRCm39) N144K probably damaging Het
Slc22a23 G A 13: 34,528,323 (GRCm39) T153I probably benign Het
Slfn8 A G 11: 82,908,280 (GRCm39) S88P probably benign Het
Stpg3 T A 2: 25,103,875 (GRCm39) M154L probably benign Het
Vmn2r115 G A 17: 23,564,146 (GRCm39) C106Y probably damaging Het
Washc3 C T 10: 88,055,122 (GRCm39) T112M probably benign Het
Zfp280d C T 9: 72,229,806 (GRCm39) T346M probably damaging Het
Other mutations in Cntrob
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02975:Cntrob APN 11 69,210,199 (GRCm39) missense possibly damaging 0.66
IGL03173:Cntrob APN 11 69,200,853 (GRCm39) missense possibly damaging 0.90
groats UTSW 11 69,200,317 (GRCm39) nonsense probably null
BB005:Cntrob UTSW 11 69,191,121 (GRCm39) missense probably damaging 0.97
BB015:Cntrob UTSW 11 69,191,121 (GRCm39) missense probably damaging 0.97
R0270:Cntrob UTSW 11 69,202,167 (GRCm39) missense possibly damaging 0.66
R0501:Cntrob UTSW 11 69,213,694 (GRCm39) missense probably damaging 1.00
R1749:Cntrob UTSW 11 69,213,700 (GRCm39) missense probably damaging 0.99
R1775:Cntrob UTSW 11 69,211,693 (GRCm39) missense possibly damaging 0.90
R1900:Cntrob UTSW 11 69,198,880 (GRCm39) missense probably benign 0.27
R1967:Cntrob UTSW 11 69,211,789 (GRCm39) missense probably damaging 0.97
R2495:Cntrob UTSW 11 69,213,749 (GRCm39) missense probably damaging 0.96
R3121:Cntrob UTSW 11 69,213,526 (GRCm39) nonsense probably null
R4449:Cntrob UTSW 11 69,196,375 (GRCm39) missense probably benign 0.29
R4696:Cntrob UTSW 11 69,211,714 (GRCm39) missense probably damaging 1.00
R4841:Cntrob UTSW 11 69,206,220 (GRCm39) missense possibly damaging 0.92
R4842:Cntrob UTSW 11 69,206,220 (GRCm39) missense possibly damaging 0.92
R4908:Cntrob UTSW 11 69,211,732 (GRCm39) missense probably damaging 0.97
R4982:Cntrob UTSW 11 69,202,188 (GRCm39) splice site probably null
R5168:Cntrob UTSW 11 69,190,816 (GRCm39) missense possibly damaging 0.66
R5187:Cntrob UTSW 11 69,212,717 (GRCm39) missense possibly damaging 0.62
R5307:Cntrob UTSW 11 69,205,576 (GRCm39) missense possibly damaging 0.66
R5473:Cntrob UTSW 11 69,213,579 (GRCm39) missense possibly damaging 0.81
R5903:Cntrob UTSW 11 69,200,201 (GRCm39) missense possibly damaging 0.83
R6643:Cntrob UTSW 11 69,202,248 (GRCm39) missense possibly damaging 0.46
R6742:Cntrob UTSW 11 69,213,749 (GRCm39) missense probably damaging 0.96
R6964:Cntrob UTSW 11 69,200,317 (GRCm39) nonsense probably null
R7020:Cntrob UTSW 11 69,193,918 (GRCm39) critical splice donor site probably null
R7425:Cntrob UTSW 11 69,205,560 (GRCm39) nonsense probably null
R7928:Cntrob UTSW 11 69,191,121 (GRCm39) missense probably damaging 0.97
R7946:Cntrob UTSW 11 69,206,047 (GRCm39) missense possibly damaging 0.82
R8348:Cntrob UTSW 11 69,190,679 (GRCm39) missense unknown
R8448:Cntrob UTSW 11 69,190,679 (GRCm39) missense unknown
R8539:Cntrob UTSW 11 69,211,652 (GRCm39) missense possibly damaging 0.94
R9259:Cntrob UTSW 11 69,211,665 (GRCm39) missense possibly damaging 0.81
R9415:Cntrob UTSW 11 69,193,741 (GRCm39) missense possibly damaging 0.66
R9553:Cntrob UTSW 11 69,205,679 (GRCm39) missense probably benign 0.00
R9626:Cntrob UTSW 11 69,202,167 (GRCm39) missense possibly damaging 0.66
R9628:Cntrob UTSW 11 69,213,782 (GRCm39) missense possibly damaging 0.66
R9801:Cntrob UTSW 11 69,212,233 (GRCm39) missense possibly damaging 0.82
Z1177:Cntrob UTSW 11 69,202,275 (GRCm39) missense possibly damaging 0.66
Z1186:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1186:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Z1187:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1187:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Z1188:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1188:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Z1189:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1189:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Z1190:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1190:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Z1191:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1191:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Z1192:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1192:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGTACAGGCTCATGGGTTGG -3'
(R):5'- AGACCGTCCTAGGTTCCTAG -3'

Sequencing Primer
(F):5'- TGGGGAAACTGTGACTCTACATTTC -3'
(R):5'- CTAGGTTCCTAGGGAAATGGACAC -3'
Posted On 2015-03-25