Incidental Mutation 'R3780:Olfr123'
ID272031
Institutional Source Beutler Lab
Gene Symbol Olfr123
Ensembl Gene ENSMUSG00000045202
Gene Nameolfactory receptor 123
SynonymsMOR256-9, GA_x6K02T2PSCP-2255106-2256035
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R3780 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location37793529-37798134 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 37796004 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Glycine at position 187 (C187G)
Ref Sequence ENSEMBL: ENSMUSP00000149802 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054748] [ENSMUST00000214770] [ENSMUST00000215168] [ENSMUST00000216051] [ENSMUST00000216478]
Predicted Effect probably damaging
Transcript: ENSMUST00000054748
AA Change: C187G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058678
Gene: ENSMUSG00000045202
AA Change: C187G

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srv 23 163 2.9e-6 PFAM
Pfam:7tm_4 29 306 2.3e-44 PFAM
Pfam:7TM_GPCR_Srsx 33 144 2.4e-5 PFAM
Pfam:7tm_1 39 288 1.1e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174446
Predicted Effect probably damaging
Transcript: ENSMUST00000214770
AA Change: C187G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000215168
Predicted Effect probably damaging
Transcript: ENSMUST00000216051
AA Change: C187G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000216478
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 93% (40/43)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik G T 7: 29,560,838 noncoding transcript Het
Adam21 C T 12: 81,559,273 V572I probably damaging Het
Arhgap32 T A 9: 32,152,019 probably null Het
Carmil1 A T 13: 24,137,169 I281N probably damaging Het
Cdh12 T A 15: 21,585,977 probably null Het
Cdh7 T A 1: 110,049,004 V133E probably benign Het
Cntrob A G 11: 69,302,882 L814P probably damaging Het
Csmd1 T C 8: 16,201,986 N952S probably damaging Het
Cspg4 A G 9: 56,888,233 Y1084C probably damaging Het
Dlg5 A G 14: 24,190,310 probably benign Het
Glis2 T C 16: 4,613,896 probably benign Het
Hif3a T C 7: 17,054,713 E111G probably damaging Het
Kctd4 A G 14: 75,962,811 D74G probably benign Het
Kif21b A T 1: 136,156,226 K737M probably damaging Het
Ktn1 G A 14: 47,706,403 probably benign Het
Lama2 A T 10: 27,459,339 N113K probably damaging Het
Ltv1 A G 10: 13,179,200 S409P probably benign Het
Mgat4c A G 10: 102,388,921 E332G probably benign Het
Myh6 A G 14: 54,963,958 F95L probably benign Het
Ndufa4l2 A G 10: 127,515,420 I27V probably benign Het
Npepl1 T G 2: 174,120,654 L371R probably damaging Het
Nudt9 A G 5: 104,047,106 T23A probably benign Het
Ocrl G A X: 47,938,303 V416I probably benign Het
Padi2 C T 4: 140,917,737 T94I probably benign Het
Pcca G A 14: 122,684,885 E353K probably damaging Het
Pcdhgb2 T A 18: 37,691,757 N600K probably damaging Het
Pex5l A G 3: 32,950,844 L593P probably damaging Het
Rbp2 G A 9: 98,498,826 D62N probably benign Het
Rock1 G T 18: 10,067,575 N1319K probably benign Het
Ror1 A C 4: 100,412,117 D384A probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Sacm1l A T 9: 123,552,790 E152D probably benign Het
Seh1l T C 18: 67,775,017 V3A probably benign Het
Serpinb6d T A 13: 33,664,114 D20E probably benign Het
Serpini1 T G 3: 75,614,635 N144K probably damaging Het
Slc22a23 G A 13: 34,344,340 T153I probably benign Het
Slfn8 A G 11: 83,017,454 S88P probably benign Het
Stpg3 T A 2: 25,213,863 M154L probably benign Het
Vmn2r115 G A 17: 23,345,172 C106Y probably damaging Het
Washc3 C T 10: 88,219,260 T112M probably benign Het
Zfp280d C T 9: 72,322,524 T346M probably damaging Het
Other mutations in Olfr123
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01409:Olfr123 APN 17 37795522 missense probably damaging 0.99
IGL03030:Olfr123 APN 17 37796271 missense probably damaging 1.00
IGL03107:Olfr123 APN 17 37795788 missense probably benign 0.01
R0329:Olfr123 UTSW 17 37795989 missense probably benign 0.01
R0330:Olfr123 UTSW 17 37795989 missense probably benign 0.01
R0524:Olfr123 UTSW 17 37795605 nonsense probably null
R0581:Olfr123 UTSW 17 37796102 missense probably damaging 1.00
R1288:Olfr123 UTSW 17 37795693 missense probably damaging 0.98
R1897:Olfr123 UTSW 17 37796184 missense probably benign 0.22
R3751:Olfr123 UTSW 17 37796232 missense possibly damaging 0.95
R3753:Olfr123 UTSW 17 37796232 missense possibly damaging 0.95
R3947:Olfr123 UTSW 17 37796115 missense probably benign
R5925:Olfr123 UTSW 17 37795591 missense probably benign 0.00
R5987:Olfr123 UTSW 17 37796357 missense probably benign
R6369:Olfr123 UTSW 17 37795496 missense probably benign 0.02
R6891:Olfr123 UTSW 17 37795504 missense probably benign
R7320:Olfr123 UTSW 17 37796357 missense probably benign
R7997:Olfr123 UTSW 17 37796162 nonsense probably null
R8153:Olfr123 UTSW 17 37795476 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAGCAGTGATGAATCCACAGC -3'
(R):5'- GCATATGAACTGTTCGGCTGG -3'

Sequencing Primer
(F):5'- GTGATGAATCCACAGCTCTGC -3'
(R):5'- TGGCTGTGATGCTCCCATAAAAG -3'
Posted On2015-03-25