Incidental Mutation 'R3780:Ocrl'
ID 272033
Institutional Source Beutler Lab
Gene Symbol Ocrl
Ensembl Gene ENSMUSG00000001173
Gene Name OCRL, inositol polyphosphate-5-phosphatase
Synonyms 9530014D17Rik, OCRL1
Accession Numbers

Genbank: NM_177215; MGI: 109589

Is this an essential gene? Possibly non essential (E-score: 0.316) question?
Stock # R3780 (G1)
Quality Score 222
Status Validated
Chromosome X
Chromosomal Location 47912387-47965868 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 47938303 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 416 (V416I)
Ref Sequence ENSEMBL: ENSMUSP00000110672 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001202] [ENSMUST00000115020]
AlphaFold Q6NVF0
Predicted Effect probably benign
Transcript: ENSMUST00000001202
AA Change: V416I

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000001202
Gene: ENSMUSG00000001173
AA Change: V416I

DomainStartEndE-ValueType
Pfam:OCRL_clath_bd 18 118 1.5e-47 PFAM
low complexity region 168 189 N/A INTRINSIC
IPPc 237 538 1.16e-147 SMART
Blast:RhoGAP 673 704 2e-11 BLAST
RhoGAP 731 895 4.93e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115020
AA Change: V416I

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000110672
Gene: ENSMUSG00000001173
AA Change: V416I

DomainStartEndE-ValueType
PDB:2KIE|A 1 119 7e-69 PDB
low complexity region 168 189 N/A INTRINSIC
IPPc 237 538 1.16e-147 SMART
PDB:2QV2|A 561 722 1e-97 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142719
Predicted Effect probably benign
Transcript: ENSMUST00000154732
SMART Domains Protein: ENSMUSP00000122084
Gene: ENSMUSG00000001173

DomainStartEndE-ValueType
Pfam:Exo_endo_phos 1 79 5.9e-6 PFAM
Blast:IPPc 139 175 5e-13 BLAST
PDB:3QBT|H 144 266 7e-83 PDB
Meta Mutation Damage Score 0.3517 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 93% (40/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an inositol polyphosphate 5-phosphatase. This protein is involved in regulating membrane trafficking and is located in numerous subcellular locations including the trans-Golgi network, clathrin-coated vesicles and, endosomes and the plasma membrane. This protein may also play a role in primary cilium formation. Mutations in this gene cause oculocerebrorenal syndrome of Lowe and also Dent disease. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous null mice do not develop and of the abnormalities associated with oculocerebrorenal syndrome of Lowe. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, knock-out(2) Gene trapped(4)

Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik G T 7: 29,560,838 noncoding transcript Het
Adam21 C T 12: 81,559,273 V572I probably damaging Het
Arhgap32 T A 9: 32,152,019 probably null Het
Carmil1 A T 13: 24,137,169 I281N probably damaging Het
Cdh12 T A 15: 21,585,977 probably null Het
Cdh7 T A 1: 110,049,004 V133E probably benign Het
Cntrob A G 11: 69,302,882 L814P probably damaging Het
Csmd1 T C 8: 16,201,986 N952S probably damaging Het
Cspg4 A G 9: 56,888,233 Y1084C probably damaging Het
Dlg5 A G 14: 24,190,310 probably benign Het
Glis2 T C 16: 4,613,896 probably benign Het
Hif3a T C 7: 17,054,713 E111G probably damaging Het
Kctd4 A G 14: 75,962,811 D74G probably benign Het
Kif21b A T 1: 136,156,226 K737M probably damaging Het
Ktn1 G A 14: 47,706,403 probably benign Het
Lama2 A T 10: 27,459,339 N113K probably damaging Het
Ltv1 A G 10: 13,179,200 S409P probably benign Het
Mgat4c A G 10: 102,388,921 E332G probably benign Het
Myh6 A G 14: 54,963,958 F95L probably benign Het
Ndufa4l2 A G 10: 127,515,420 I27V probably benign Het
Npepl1 T G 2: 174,120,654 L371R probably damaging Het
Nudt9 A G 5: 104,047,106 T23A probably benign Het
Olfr123 T G 17: 37,796,004 C187G probably damaging Het
Padi2 C T 4: 140,917,737 T94I probably benign Het
Pcca G A 14: 122,684,885 E353K probably damaging Het
Pcdhgb2 T A 18: 37,691,757 N600K probably damaging Het
Pex5l A G 3: 32,950,844 L593P probably damaging Het
Rbp2 G A 9: 98,498,826 D62N probably benign Het
Rock1 G T 18: 10,067,575 N1319K probably benign Het
Ror1 A C 4: 100,412,117 D384A probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Sacm1l A T 9: 123,552,790 E152D probably benign Het
Seh1l T C 18: 67,775,017 V3A probably benign Het
Serpinb6d T A 13: 33,664,114 D20E probably benign Het
Serpini1 T G 3: 75,614,635 N144K probably damaging Het
Slc22a23 G A 13: 34,344,340 T153I probably benign Het
Slfn8 A G 11: 83,017,454 S88P probably benign Het
Stpg3 T A 2: 25,213,863 M154L probably benign Het
Vmn2r115 G A 17: 23,345,172 C106Y probably damaging Het
Washc3 C T 10: 88,219,260 T112M probably benign Het
Zfp280d C T 9: 72,322,524 T346M probably damaging Het
Other mutations in Ocrl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00925:Ocrl APN X 47947097 missense probably benign 0.04
IGL02142:Ocrl APN X 47936118 missense probably damaging 0.98
IGL02494:Ocrl APN X 47933438 missense probably benign
IGL02496:Ocrl APN X 47933438 missense probably benign
D4043:Ocrl UTSW X 47936323 missense probably benign 0.44
R0599:Ocrl UTSW X 47936086 unclassified probably benign
R1834:Ocrl UTSW X 47962116 missense probably damaging 1.00
R1835:Ocrl UTSW X 47962116 missense probably damaging 1.00
R1836:Ocrl UTSW X 47962116 missense probably damaging 1.00
R3113:Ocrl UTSW X 47933427 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTTTCCTAGGTATTGGCAGTAC -3'
(R):5'- GGCGCTCCAAATCTCTATATCC -3'

Sequencing Primer
(F):5'- CAGTACTTGCCCCTAAAGAA -3'
(R):5'- CAAGACAGTATGACTTGTCATCTC -3'
Posted On 2015-03-25