Incidental Mutation 'R3781:Hlx'
ID272036
Institutional Source Beutler Lab
Gene Symbol Hlx
Ensembl Gene ENSMUSG00000039377
Gene NameH2.0-like homeobox
SynonymsHlx1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3781 (G1)
Quality Score223
Status Not validated
Chromosome1
Chromosomal Location184727140-184732619 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 184731987 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Aspartic acid at position 52 (A52D)
Ref Sequence ENSEMBL: ENSMUSP00000040505 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048572] [ENSMUST00000174257]
Predicted Effect probably damaging
Transcript: ENSMUST00000048572
AA Change: A52D

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000040505
Gene: ENSMUSG00000039377
AA Change: A52D

DomainStartEndE-ValueType
low complexity region 52 63 N/A INTRINSIC
low complexity region 123 149 N/A INTRINSIC
low complexity region 157 168 N/A INTRINSIC
HOX 271 335 2.32e-22 SMART
low complexity region 353 379 N/A INTRINSIC
low complexity region 405 434 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174257
SMART Domains Protein: ENSMUSP00000134728
Gene: ENSMUSG00000039377

DomainStartEndE-ValueType
low complexity region 52 63 N/A INTRINSIC
low complexity region 123 149 N/A INTRINSIC
low complexity region 157 168 N/A INTRINSIC
low complexity region 221 271 N/A INTRINSIC
low complexity region 344 357 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192139
Meta Mutation Damage Score 0.0763 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for disrputions in this gene die as embryos as a result of defective organogenesis and fetal hematopoiesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bap1 T C 14: 31,257,618 I526T possibly damaging Het
Calcr T C 6: 3,700,193 T263A possibly damaging Het
Cdh7 T A 1: 110,049,004 V133E probably benign Het
Ddx5 T C 11: 106,784,520 I330V probably benign Het
Dysf G A 6: 84,186,509 probably null Het
Gnl2 T C 4: 125,037,606 V110A probably damaging Het
H2-Q10 A G 17: 35,471,018 Y179C possibly damaging Het
Map3k20 A G 2: 72,402,355 probably benign Het
Mcm7 G A 5: 138,164,736 R385W probably damaging Het
Mgat4c A G 10: 102,388,921 E332G probably benign Het
Nudt3 A G 17: 27,580,808 S134P possibly damaging Het
Olfr1186 A T 2: 88,526,365 T261S probably benign Het
Olfr1212 G T 2: 88,958,747 E94* probably null Het
Olfr385 C A 11: 73,589,013 G242C probably damaging Het
Olfr385 A T 11: 73,589,368 Y123* probably null Het
Olfr573-ps1 T C 7: 102,942,071 I169V probably benign Het
Pcnx A G 12: 81,996,118 T2325A probably benign Het
Plekha6 A G 1: 133,294,655 E993G probably damaging Het
Psmd4 T A 3: 95,036,728 Y15F probably benign Het
Rad23b C T 4: 55,382,586 T263M probably damaging Het
Stpg3 T A 2: 25,213,863 M154L probably benign Het
Vmn1r45 C A 6: 89,933,817 R57L probably benign Het
Zfp658 G A 7: 43,573,846 R515H probably benign Het
Other mutations in Hlx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00471:Hlx APN 1 184731595 missense probably damaging 1.00
IGL01074:Hlx APN 1 184727813 missense probably damaging 1.00
IGL02543:Hlx APN 1 184730751 missense probably damaging 1.00
R0522:Hlx UTSW 1 184731640 missense probably damaging 1.00
R1104:Hlx UTSW 1 184731987 missense probably damaging 0.99
R1157:Hlx UTSW 1 184731987 missense probably damaging 0.99
R1158:Hlx UTSW 1 184731987 missense probably damaging 0.99
R1285:Hlx UTSW 1 184731987 missense probably damaging 0.99
R1286:Hlx UTSW 1 184731987 missense probably damaging 0.99
R1439:Hlx UTSW 1 184731987 missense probably damaging 0.99
R1489:Hlx UTSW 1 184731987 missense probably damaging 0.99
R1606:Hlx UTSW 1 184731987 missense probably damaging 0.99
R1974:Hlx UTSW 1 184731987 missense probably damaging 0.99
R1976:Hlx UTSW 1 184731987 missense probably damaging 0.99
R2161:Hlx UTSW 1 184727641 missense probably benign 0.12
R2162:Hlx UTSW 1 184730692 splice site probably null
R2340:Hlx UTSW 1 184731987 missense probably damaging 0.99
R2341:Hlx UTSW 1 184731987 missense probably damaging 0.99
R3237:Hlx UTSW 1 184731987 missense probably damaging 0.99
R3782:Hlx UTSW 1 184731987 missense probably damaging 0.99
R5705:Hlx UTSW 1 184730865 missense probably benign 0.40
R5738:Hlx UTSW 1 184731557 critical splice donor site probably null
R6081:Hlx UTSW 1 184727697 missense probably benign
R7323:Hlx UTSW 1 184730796 missense probably benign 0.00
R7373:Hlx UTSW 1 184730865 missense probably benign 0.40
R7908:Hlx UTSW 1 184727576 missense probably benign
R7938:Hlx UTSW 1 184731928 missense probably benign 0.00
R7985:Hlx UTSW 1 184732026 missense probably benign 0.00
R8303:Hlx UTSW 1 184727708 missense probably damaging 1.00
X0018:Hlx UTSW 1 184727732 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- TCCGCAGACAAAATTCGATCG -3'
(R):5'- TTTCAAGCCAAGCCAGGGG -3'

Sequencing Primer
(F):5'- CGATCGATACCAAATTTGAGGTC -3'
(R):5'- CGAAGAACCGAAAGCAGCTCG -3'
Posted On2015-03-25