Incidental Mutation 'R3781:Stpg3'
ID272037
Institutional Source Beutler Lab
Gene Symbol Stpg3
Ensembl Gene ENSMUSG00000036770
Gene Namesperm tail PG rich repeat containing 3
Synonyms4933433C11Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R3781 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location25212207-25214637 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 25213863 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 154 (M154L)
Ref Sequence ENSEMBL: ENSMUSP00000037603 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028346] [ENSMUST00000043774] [ENSMUST00000059849] [ENSMUST00000114363]
Predicted Effect probably benign
Transcript: ENSMUST00000028346
SMART Domains Protein: ENSMUSP00000028346
Gene: ENSMUSG00000026969

DomainStartEndE-ValueType
Pfam:DUF2475 13 71 8.1e-16 PFAM
low complexity region 130 139 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000043774
AA Change: M154L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000037603
Gene: ENSMUSG00000036770
AA Change: M154L

DomainStartEndE-ValueType
Pfam:SHIPPO-rpt 103 145 9.5e-4 PFAM
Pfam:SHIPPO-rpt 226 255 1.4e-3 PFAM
Pfam:SHIPPO-rpt 265 291 1.4e-3 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000059849
SMART Domains Protein: ENSMUSP00000057731
Gene: ENSMUSG00000013465

DomainStartEndE-ValueType
Pfam:COBRA1 107 578 3.5e-248 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114363
AA Change: M99L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000110003
Gene: ENSMUSG00000036770
AA Change: M99L

DomainStartEndE-ValueType
Pfam:SHIPPO-rpt 48 79 2.8e-4 PFAM
Pfam:SHIPPO-rpt 110 136 1.2e-1 PFAM
Pfam:SHIPPO-rpt 152 200 3.5e-1 PFAM
Pfam:SHIPPO-rpt 210 248 1.9e-3 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124661
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128876
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138199
Predicted Effect probably benign
Transcript: ENSMUST00000140934
SMART Domains Protein: ENSMUSP00000115698
Gene: ENSMUSG00000013465

DomainStartEndE-ValueType
Pfam:COBRA1 40 204 9.7e-106 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147890
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149509
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155706
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205741
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bap1 T C 14: 31,257,618 I526T possibly damaging Het
Calcr T C 6: 3,700,193 T263A possibly damaging Het
Cdh7 T A 1: 110,049,004 V133E probably benign Het
Ddx5 T C 11: 106,784,520 I330V probably benign Het
Dysf G A 6: 84,186,509 probably null Het
Gnl2 T C 4: 125,037,606 V110A probably damaging Het
H2-Q10 A G 17: 35,471,018 Y179C possibly damaging Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Map3k20 A G 2: 72,402,355 probably benign Het
Mcm7 G A 5: 138,164,736 R385W probably damaging Het
Mgat4c A G 10: 102,388,921 E332G probably benign Het
Nudt3 A G 17: 27,580,808 S134P possibly damaging Het
Olfr1186 A T 2: 88,526,365 T261S probably benign Het
Olfr1212 G T 2: 88,958,747 E94* probably null Het
Olfr385 C A 11: 73,589,013 G242C probably damaging Het
Olfr385 A T 11: 73,589,368 Y123* probably null Het
Olfr573-ps1 T C 7: 102,942,071 I169V probably benign Het
Pcnx A G 12: 81,996,118 T2325A probably benign Het
Plekha6 A G 1: 133,294,655 E993G probably damaging Het
Psmd4 T A 3: 95,036,728 Y15F probably benign Het
Rad23b C T 4: 55,382,586 T263M probably damaging Het
Vmn1r45 C A 6: 89,933,817 R57L probably benign Het
Zfp658 G A 7: 43,573,846 R515H probably benign Het
Other mutations in Stpg3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01116:Stpg3 APN 2 25213179 unclassified probably benign
IGL01450:Stpg3 APN 2 25214610 unclassified probably benign
R1413:Stpg3 UTSW 2 25213850 missense probably damaging 1.00
R1612:Stpg3 UTSW 2 25213854 missense probably benign 0.00
R3780:Stpg3 UTSW 2 25213863 missense probably benign 0.00
R4694:Stpg3 UTSW 2 25213297 missense probably damaging 0.96
R5029:Stpg3 UTSW 2 25214564 missense probably damaging 0.97
R5406:Stpg3 UTSW 2 25213568 nonsense probably null
R7202:Stpg3 UTSW 2 25214574 missense probably damaging 1.00
R8458:Stpg3 UTSW 2 25213321 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCCTGATCCATGCTTTTGTG -3'
(R):5'- AATACACCATCGGTCGCAAG -3'

Sequencing Primer
(F):5'- GGTTCTCCCTCTACGCCAAAC -3'
(R):5'- AAGTACCCGGTTCGAGGTG -3'
Posted On2015-03-25