Incidental Mutation 'R3781:Olfr1212'
ID272039
Institutional Source Beutler Lab
Gene Symbol Olfr1212
Ensembl Gene ENSMUSG00000048226
Gene Nameolfactory receptor 1212
SynonymsGA_x6K02T2Q125-50437014-50437949, MOR233-20, MOR233-17
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R3781 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location88953969-88961313 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 88958747 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 94 (E94*)
Ref Sequence ENSEMBL: ENSMUSP00000149781 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055895] [ENSMUST00000215781]
Predicted Effect probably null
Transcript: ENSMUST00000055895
AA Change: E94*
SMART Domains Protein: ENSMUSP00000052837
Gene: ENSMUSG00000048226
AA Change: E94*

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 1.9e-46 PFAM
Pfam:7tm_1 39 286 7.1e-15 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000215781
AA Change: E94*
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bap1 T C 14: 31,257,618 I526T possibly damaging Het
Calcr T C 6: 3,700,193 T263A possibly damaging Het
Cdh7 T A 1: 110,049,004 V133E probably benign Het
Ddx5 T C 11: 106,784,520 I330V probably benign Het
Dysf G A 6: 84,186,509 probably null Het
Gnl2 T C 4: 125,037,606 V110A probably damaging Het
H2-Q10 A G 17: 35,471,018 Y179C possibly damaging Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Map3k20 A G 2: 72,402,355 probably benign Het
Mcm7 G A 5: 138,164,736 R385W probably damaging Het
Mgat4c A G 10: 102,388,921 E332G probably benign Het
Nudt3 A G 17: 27,580,808 S134P possibly damaging Het
Olfr1186 A T 2: 88,526,365 T261S probably benign Het
Olfr385 C A 11: 73,589,013 G242C probably damaging Het
Olfr385 A T 11: 73,589,368 Y123* probably null Het
Olfr573-ps1 T C 7: 102,942,071 I169V probably benign Het
Pcnx A G 12: 81,996,118 T2325A probably benign Het
Plekha6 A G 1: 133,294,655 E993G probably damaging Het
Psmd4 T A 3: 95,036,728 Y15F probably benign Het
Rad23b C T 4: 55,382,586 T263M probably damaging Het
Stpg3 T A 2: 25,213,863 M154L probably benign Het
Vmn1r45 C A 6: 89,933,817 R57L probably benign Het
Zfp658 G A 7: 43,573,846 R515H probably benign Het
Other mutations in Olfr1212
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Olfr1212 APN 2 88958766 missense probably damaging 0.98
IGL01398:Olfr1212 APN 2 88958849 missense probably damaging 1.00
IGL01537:Olfr1212 APN 2 88958541 missense probably benign 0.00
IGL02197:Olfr1212 APN 2 88958684 missense probably benign 0.05
IGL02557:Olfr1212 APN 2 88958681 missense probably benign 0.00
R0276:Olfr1212 UTSW 2 88958755 nonsense probably null
R0568:Olfr1212 UTSW 2 88959043 nonsense probably null
R0699:Olfr1212 UTSW 2 88958616 missense probably benign 0.31
R1101:Olfr1212 UTSW 2 88958984 missense possibly damaging 0.60
R1205:Olfr1212 UTSW 2 88958588 missense probably benign 0.00
R1468:Olfr1212 UTSW 2 88959043 nonsense probably null
R1468:Olfr1212 UTSW 2 88959043 nonsense probably null
R1845:Olfr1212 UTSW 2 88958867 missense probably damaging 0.99
R2031:Olfr1212 UTSW 2 88959299 missense probably benign 0.19
R2418:Olfr1212 UTSW 2 88959036 missense probably benign 0.01
R2419:Olfr1212 UTSW 2 88959036 missense probably benign 0.01
R4049:Olfr1212 UTSW 2 88959273 missense probably benign 0.09
R4440:Olfr1212 UTSW 2 88959341 missense probably benign 0.22
R4583:Olfr1212 UTSW 2 88959212 missense probably damaging 0.99
R4646:Olfr1212 UTSW 2 88959212 missense probably damaging 0.99
R4648:Olfr1212 UTSW 2 88959212 missense probably damaging 0.99
R4674:Olfr1212 UTSW 2 88958872 missense probably damaging 0.98
R4851:Olfr1212 UTSW 2 88958586 missense probably damaging 1.00
R4971:Olfr1212 UTSW 2 88958519 missense probably damaging 1.00
R5610:Olfr1212 UTSW 2 88958826 missense probably damaging 1.00
R5805:Olfr1212 UTSW 2 88958641 missense possibly damaging 0.50
R5887:Olfr1212 UTSW 2 88958754 missense possibly damaging 0.60
R6023:Olfr1212 UTSW 2 88958715 missense possibly damaging 0.76
R6118:Olfr1212 UTSW 2 88959118 nonsense probably null
R7490:Olfr1212 UTSW 2 88959048 missense probably benign 0.00
R7542:Olfr1212 UTSW 2 88958775 missense probably benign 0.01
R7612:Olfr1212 UTSW 2 88958505 missense probably damaging 1.00
R7972:Olfr1212 UTSW 2 88958833 nonsense probably null
R8422:Olfr1212 UTSW 2 88958997 missense probably benign 0.05
Z1177:Olfr1212 UTSW 2 88959377 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCAGAGAACCCAACTGTTCAG -3'
(R):5'- TGGGTCCACAAAAGGGTAGC -3'

Sequencing Primer
(F):5'- GAGAACCCAACTGTTCAGAAAATAG -3'
(R):5'- TGATAGAATGTAAGAATCCCCCTGC -3'
Posted On2015-03-25