Incidental Mutation 'R3781:Psmd4'
ID272040
Institutional Source Beutler Lab
Gene Symbol Psmd4
Ensembl Gene ENSMUSG00000005625
Gene Nameproteasome (prosome, macropain) 26S subunit, non-ATPase, 4
SynonymsAf1, multiubiquitin-chain-binding protein, Mcb1, angiocidin
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3781 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location95032694-95042614 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 95036728 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 15 (Y15F)
Ref Sequence ENSEMBL: ENSMUSP00000102857 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071664] [ENSMUST00000107237] [ENSMUST00000117355] [ENSMUST00000140348]
Predicted Effect probably benign
Transcript: ENSMUST00000071664
AA Change: Y15F

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000071589
Gene: ENSMUSG00000005625
AA Change: Y15F

DomainStartEndE-ValueType
VWA 2 188 7.38e-12 SMART
low complexity region 189 201 N/A INTRINSIC
UIM 211 230 2.04e0 SMART
UIM 285 304 1.49e-2 SMART
low complexity region 307 320 N/A INTRINSIC
low complexity region 367 379 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107237
AA Change: Y15F

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000102857
Gene: ENSMUSG00000005625
AA Change: Y15F

DomainStartEndE-ValueType
VWA 2 188 7.38e-12 SMART
low complexity region 189 201 N/A INTRINSIC
UIM 211 230 2.04e0 SMART
UIM 282 301 1.49e-2 SMART
low complexity region 304 317 N/A INTRINSIC
low complexity region 364 376 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117355
AA Change: Y15F

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000113554
Gene: ENSMUSG00000005625
AA Change: Y15F

DomainStartEndE-ValueType
VWA 2 188 7.38e-12 SMART
low complexity region 189 201 N/A INTRINSIC
UIM 211 230 2.04e0 SMART
UIM 285 304 1.49e-2 SMART
low complexity region 307 320 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136868
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140280
Predicted Effect probably benign
Transcript: ENSMUST00000140348
SMART Domains Protein: ENSMUSP00000114545
Gene: ENSMUSG00000005625

DomainStartEndE-ValueType
Pfam:UIM 34 42 2.4e-3 PFAM
UIM 100 119 1.49e-2 SMART
low complexity region 122 135 N/A INTRINSIC
low complexity region 182 194 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143688
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147960
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes one of the non-ATPase subunits of the 19S regulator lid. Pseudogenes have been identified on chromosomes 10 and 21. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality and abnormal embryogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bap1 T C 14: 31,257,618 I526T possibly damaging Het
Calcr T C 6: 3,700,193 T263A possibly damaging Het
Cdh7 T A 1: 110,049,004 V133E probably benign Het
Ddx5 T C 11: 106,784,520 I330V probably benign Het
Dysf G A 6: 84,186,509 probably null Het
Gnl2 T C 4: 125,037,606 V110A probably damaging Het
H2-Q10 A G 17: 35,471,018 Y179C possibly damaging Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Map3k20 A G 2: 72,402,355 probably benign Het
Mcm7 G A 5: 138,164,736 R385W probably damaging Het
Mgat4c A G 10: 102,388,921 E332G probably benign Het
Nudt3 A G 17: 27,580,808 S134P possibly damaging Het
Olfr1186 A T 2: 88,526,365 T261S probably benign Het
Olfr1212 G T 2: 88,958,747 E94* probably null Het
Olfr385 C A 11: 73,589,013 G242C probably damaging Het
Olfr385 A T 11: 73,589,368 Y123* probably null Het
Olfr573-ps1 T C 7: 102,942,071 I169V probably benign Het
Pcnx A G 12: 81,996,118 T2325A probably benign Het
Plekha6 A G 1: 133,294,655 E993G probably damaging Het
Rad23b C T 4: 55,382,586 T263M probably damaging Het
Stpg3 T A 2: 25,213,863 M154L probably benign Het
Vmn1r45 C A 6: 89,933,817 R57L probably benign Het
Zfp658 G A 7: 43,573,846 R515H probably benign Het
Other mutations in Psmd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02396:Psmd4 APN 3 95035910 missense probably damaging 1.00
R0173:Psmd4 UTSW 3 95032923 missense probably damaging 1.00
R1962:Psmd4 UTSW 3 95036701 missense possibly damaging 0.89
R2907:Psmd4 UTSW 3 95033962 missense probably damaging 0.99
R3783:Psmd4 UTSW 3 95035251 missense possibly damaging 0.85
R4902:Psmd4 UTSW 3 95035859 missense probably damaging 0.98
R5090:Psmd4 UTSW 3 95035248 missense possibly damaging 0.53
R8031:Psmd4 UTSW 3 95035892 missense probably damaging 1.00
X0024:Psmd4 UTSW 3 95036717 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCACCTGCAACCCAACATG -3'
(R):5'- CGAGAAGCTGGAGTTTATGTTTCATA -3'

Sequencing Primer
(F):5'- GGGAGCACCACCCACCTTC -3'
(R):5'- CCTGGAATTCATTCTGTAGACCAGG -3'
Posted On2015-03-25