Incidental Mutation 'R3781:Mcm7'
ID272043
Institutional Source Beutler Lab
Gene Symbol Mcm7
Ensembl Gene ENSMUSG00000029730
Gene Nameminichromosome maintenance complex component 7
SynonymsMcmd7, mCDC47
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3781 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location138164583-138172422 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 138164736 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 385 (R385W)
Ref Sequence ENSEMBL: ENSMUSP00000116131 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000505] [ENSMUST00000019638] [ENSMUST00000110951] [ENSMUST00000132639] [ENSMUST00000139983] [ENSMUST00000147920] [ENSMUST00000148879] [ENSMUST00000153867] [ENSMUST00000155902] [ENSMUST00000148094]
Predicted Effect possibly damaging
Transcript: ENSMUST00000000505
AA Change: R715W

PolyPhen 2 Score 0.825 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000000505
Gene: ENSMUSG00000029730
AA Change: R715W

DomainStartEndE-ValueType
Blast:MCM 48 132 1e-41 BLAST
MCM 145 642 N/A SMART
AAA 373 526 2.9e-4 SMART
Blast:MCM 658 719 1e-32 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000019638
SMART Domains Protein: ENSMUSP00000019638
Gene: ENSMUSG00000019494

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
JAB_MPN 37 170 9.73e-35 SMART
Pfam:MitMem_reg 191 304 1.1e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083460
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083580
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083593
Predicted Effect probably benign
Transcript: ENSMUST00000110951
SMART Domains Protein: ENSMUSP00000106576
Gene: ENSMUSG00000019494

DomainStartEndE-ValueType
JAB_MPN 10 143 9.73e-35 SMART
Pfam:MitMem_reg 163 279 2.6e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125316
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127881
Predicted Effect probably benign
Transcript: ENSMUST00000132639
SMART Domains Protein: ENSMUSP00000121554
Gene: ENSMUSG00000019494

DomainStartEndE-ValueType
Pfam:MitMem_reg 17 112 3.6e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139223
Predicted Effect probably benign
Transcript: ENSMUST00000139983
SMART Domains Protein: ENSMUSP00000121446
Gene: ENSMUSG00000029730

DomainStartEndE-ValueType
Pfam:MCM_N 1 58 5.3e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142254
Predicted Effect probably benign
Transcript: ENSMUST00000147920
Predicted Effect probably damaging
Transcript: ENSMUST00000148879
AA Change: R385W

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000116131
Gene: ENSMUSG00000029730
AA Change: R385W

DomainStartEndE-ValueType
Blast:MCM 48 132 6e-44 BLAST
MCM 145 389 1.77e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154867
Predicted Effect probably benign
Transcript: ENSMUST00000153867
SMART Domains Protein: ENSMUSP00000121566
Gene: ENSMUSG00000029730

DomainStartEndE-ValueType
Pfam:MCM_N 1 58 9.5e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155902
SMART Domains Protein: ENSMUSP00000120243
Gene: ENSMUSG00000029730

DomainStartEndE-ValueType
Pfam:MCM_N 1 58 5.3e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148094
SMART Domains Protein: ENSMUSP00000121344
Gene: ENSMUSG00000029730

DomainStartEndE-ValueType
Blast:MCM 1 25 4e-7 BLAST
Meta Mutation Damage Score 0.0896 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of the highly conserved mini-chromosome maintenance proteins (MCM) that are essential for the initiation of eukaryotic genome replication. The hexameric protein complex formed by the MCM proteins is a key component of the pre-replication complex (pre_RC) and may be involved in the formation of replication forks and in the recruitment of other DNA replication related proteins. The MCM complex consisting of this protein and MCM2, 4 and 6 proteins possesses DNA helicase activity, and may act as a DNA unwinding enzyme. Cyclin D1-dependent kinase, CDK4, is found to associate with this protein, and may regulate the binding of this protein with the tumorsuppressor protein RB1/RB. Alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit prenatal lethality. Mice heterozygous for this allele exhibit increased micronulei-containing red blood cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bap1 T C 14: 31,257,618 I526T possibly damaging Het
Calcr T C 6: 3,700,193 T263A possibly damaging Het
Cdh7 T A 1: 110,049,004 V133E probably benign Het
Ddx5 T C 11: 106,784,520 I330V probably benign Het
Dysf G A 6: 84,186,509 probably null Het
Gnl2 T C 4: 125,037,606 V110A probably damaging Het
H2-Q10 A G 17: 35,471,018 Y179C possibly damaging Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Map3k20 A G 2: 72,402,355 probably benign Het
Mgat4c A G 10: 102,388,921 E332G probably benign Het
Nudt3 A G 17: 27,580,808 S134P possibly damaging Het
Olfr1186 A T 2: 88,526,365 T261S probably benign Het
Olfr1212 G T 2: 88,958,747 E94* probably null Het
Olfr385 C A 11: 73,589,013 G242C probably damaging Het
Olfr385 A T 11: 73,589,368 Y123* probably null Het
Olfr573-ps1 T C 7: 102,942,071 I169V probably benign Het
Pcnx A G 12: 81,996,118 T2325A probably benign Het
Plekha6 A G 1: 133,294,655 E993G probably damaging Het
Psmd4 T A 3: 95,036,728 Y15F probably benign Het
Rad23b C T 4: 55,382,586 T263M probably damaging Het
Stpg3 T A 2: 25,213,863 M154L probably benign Het
Vmn1r45 C A 6: 89,933,817 R57L probably benign Het
Zfp658 G A 7: 43,573,846 R515H probably benign Het
Other mutations in Mcm7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01649:Mcm7 APN 5 138169436 missense probably damaging 1.00
IGL01954:Mcm7 APN 5 138167245 missense probably damaging 1.00
IGL02611:Mcm7 APN 5 138167439 missense probably damaging 1.00
ANU23:Mcm7 UTSW 5 138170391 missense probably benign 0.02
PIT1430001:Mcm7 UTSW 5 138167446 unclassified probably benign
R0022:Mcm7 UTSW 5 138164719 makesense probably null
R1306:Mcm7 UTSW 5 138167203 missense probably damaging 1.00
R1865:Mcm7 UTSW 5 138170375 missense possibly damaging 0.47
R2132:Mcm7 UTSW 5 138169102 missense probably damaging 1.00
R3719:Mcm7 UTSW 5 138166714 nonsense probably null
R3782:Mcm7 UTSW 5 138164736 missense probably damaging 0.99
R4724:Mcm7 UTSW 5 138169125 missense probably damaging 1.00
R4882:Mcm7 UTSW 5 138165911 splice site probably null
R5012:Mcm7 UTSW 5 138169347 critical splice donor site probably null
R5517:Mcm7 UTSW 5 138164871 missense possibly damaging 0.92
R5718:Mcm7 UTSW 5 138164819 missense possibly damaging 0.95
R7604:Mcm7 UTSW 5 138169724 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CAAGGCCTTCTATCTCCCAG -3'
(R):5'- GCAGATGTGATATTTGCCACC -3'

Sequencing Primer
(F):5'- TTGACTAGCACATAGTAAGGGTC -3'
(R):5'- AGATGTGATATTTGCCACCATCCG -3'
Posted On2015-03-25