Incidental Mutation 'R3781:Vmn1r45'
ID272047
Institutional Source Beutler Lab
Gene Symbol Vmn1r45
Ensembl Gene ENSMUSG00000044248
Gene Namevomeronasal 1 receptor 45
SynonymsV1r2, V1ra2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R3781 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location89931649-89940598 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 89933817 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 57 (R57L)
Ref Sequence ENSEMBL: ENSMUSP00000154795 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054202] [ENSMUST00000226167] [ENSMUST00000227122] [ENSMUST00000227426] [ENSMUST00000227571] [ENSMUST00000227977] [ENSMUST00000228492] [ENSMUST00000228662]
Predicted Effect probably benign
Transcript: ENSMUST00000054202
AA Change: R57L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000052123
Gene: ENSMUSG00000044248
AA Change: R57L

DomainStartEndE-ValueType
Pfam:TAS2R 26 315 2.5e-10 PFAM
Pfam:V1R 54 318 1.5e-136 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226167
Predicted Effect probably benign
Transcript: ENSMUST00000227122
Predicted Effect probably benign
Transcript: ENSMUST00000227426
AA Change: R57L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000227571
Predicted Effect probably benign
Transcript: ENSMUST00000227977
AA Change: R57L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000228492
Predicted Effect probably benign
Transcript: ENSMUST00000228662
AA Change: R57L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bap1 T C 14: 31,257,618 I526T possibly damaging Het
Calcr T C 6: 3,700,193 T263A possibly damaging Het
Cdh7 T A 1: 110,049,004 V133E probably benign Het
Ddx5 T C 11: 106,784,520 I330V probably benign Het
Dysf G A 6: 84,186,509 probably null Het
Gnl2 T C 4: 125,037,606 V110A probably damaging Het
H2-Q10 A G 17: 35,471,018 Y179C possibly damaging Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Map3k20 A G 2: 72,402,355 probably benign Het
Mcm7 G A 5: 138,164,736 R385W probably damaging Het
Mgat4c A G 10: 102,388,921 E332G probably benign Het
Nudt3 A G 17: 27,580,808 S134P possibly damaging Het
Olfr1186 A T 2: 88,526,365 T261S probably benign Het
Olfr1212 G T 2: 88,958,747 E94* probably null Het
Olfr385 A T 11: 73,589,368 Y123* probably null Het
Olfr385 C A 11: 73,589,013 G242C probably damaging Het
Olfr573-ps1 T C 7: 102,942,071 I169V probably benign Het
Pcnx A G 12: 81,996,118 T2325A probably benign Het
Plekha6 A G 1: 133,294,655 E993G probably damaging Het
Psmd4 T A 3: 95,036,728 Y15F probably benign Het
Rad23b C T 4: 55,382,586 T263M probably damaging Het
Stpg3 T A 2: 25,213,863 M154L probably benign Het
Zfp658 G A 7: 43,573,846 R515H probably benign Het
Other mutations in Vmn1r45
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Vmn1r45 APN 6 89933664 missense probably damaging 1.00
IGL02010:Vmn1r45 APN 6 89933686 missense probably damaging 1.00
IGL02124:Vmn1r45 APN 6 89933053 missense probably benign 0.03
IGL02413:Vmn1r45 APN 6 89933521 missense possibly damaging 0.75
R0123:Vmn1r45 UTSW 6 89933510 nonsense probably null
R0225:Vmn1r45 UTSW 6 89933510 nonsense probably null
R1513:Vmn1r45 UTSW 6 89933076 missense probably damaging 0.97
R2154:Vmn1r45 UTSW 6 89933983 missense possibly damaging 0.91
R3082:Vmn1r45 UTSW 6 89933742 missense probably benign 0.03
R4982:Vmn1r45 UTSW 6 89933865 missense probably damaging 0.99
R5086:Vmn1r45 UTSW 6 89933100 missense probably benign 0.06
R5327:Vmn1r45 UTSW 6 89933141 missense possibly damaging 0.79
R5470:Vmn1r45 UTSW 6 89933716 missense probably benign 0.04
R6681:Vmn1r45 UTSW 6 89934003 start gained probably benign
R7046:Vmn1r45 UTSW 6 89933556 missense probably benign 0.00
R7050:Vmn1r45 UTSW 6 89933721 missense probably damaging 0.97
R7171:Vmn1r45 UTSW 6 89933334 missense probably damaging 1.00
R7236:Vmn1r45 UTSW 6 89933151 missense probably benign 0.15
R7401:Vmn1r45 UTSW 6 89933434 missense possibly damaging 0.64
R7417:Vmn1r45 UTSW 6 89933053 missense probably benign 0.03
R8068:Vmn1r45 UTSW 6 89933279 missense possibly damaging 0.53
R8223:Vmn1r45 UTSW 6 89933092 missense probably damaging 0.99
RF019:Vmn1r45 UTSW 6 89933109 missense probably damaging 0.99
X0026:Vmn1r45 UTSW 6 89933742 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAACAGGAGCTTCTGGGACTG -3'
(R):5'- TTGCCAAGGAGTGATGAGTG -3'

Sequencing Primer
(F):5'- ACTCAACATGCTGGTGGTAC -3'
(R):5'- AAGGAGTGATGAGTGAGATTCTATTC -3'
Posted On2015-03-25