Incidental Mutation 'R3781:Zfp658'
ID272048
Institutional Source Beutler Lab
Gene Symbol Zfp658
Ensembl Gene ENSMUSG00000056592
Gene Namezinc finger protein 658
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3781 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location43562256-43575461 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 43573846 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 515 (R515H)
Ref Sequence ENSEMBL: ENSMUSP00000103606 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005597] [ENSMUST00000107972]
Predicted Effect probably benign
Transcript: ENSMUST00000005597
AA Change: R515H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000005597
Gene: ENSMUSG00000056592
AA Change: R515H

DomainStartEndE-ValueType
KRAB 23 83 3.7e-27 SMART
ZnF_C2H2 276 295 8.84e1 SMART
ZnF_C2H2 301 323 5.81e-2 SMART
ZnF_C2H2 328 350 1.5e-4 SMART
ZnF_C2H2 356 378 1.84e-4 SMART
ZnF_C2H2 384 406 3.16e-3 SMART
ZnF_C2H2 412 434 1.45e-2 SMART
ZnF_C2H2 440 462 4.87e-4 SMART
ZnF_C2H2 468 490 4.87e-4 SMART
ZnF_C2H2 496 518 6.88e-4 SMART
ZnF_C2H2 524 546 1.69e-3 SMART
ZnF_C2H2 552 574 9.73e-4 SMART
ZnF_C2H2 580 602 1.82e-3 SMART
ZnF_C2H2 608 630 3.16e-3 SMART
ZnF_C2H2 636 658 8.94e-3 SMART
ZnF_C2H2 664 686 3.74e-5 SMART
ZnF_C2H2 692 714 2.99e-4 SMART
ZnF_C2H2 720 742 5.21e-4 SMART
ZnF_C2H2 748 770 2.79e-4 SMART
ZnF_C2H2 776 798 1.58e-3 SMART
ZnF_C2H2 804 826 3.44e-4 SMART
ZnF_C2H2 832 854 5.59e-4 SMART
ZnF_C2H2 860 882 5.81e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107972
AA Change: R515H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103606
Gene: ENSMUSG00000056592
AA Change: R515H

DomainStartEndE-ValueType
KRAB 23 83 3.7e-27 SMART
ZnF_C2H2 276 295 8.84e1 SMART
ZnF_C2H2 301 323 5.81e-2 SMART
ZnF_C2H2 328 350 1.5e-4 SMART
ZnF_C2H2 356 378 1.84e-4 SMART
ZnF_C2H2 384 406 3.16e-3 SMART
ZnF_C2H2 412 434 1.45e-2 SMART
ZnF_C2H2 440 462 4.87e-4 SMART
ZnF_C2H2 468 490 4.87e-4 SMART
ZnF_C2H2 496 518 6.88e-4 SMART
ZnF_C2H2 524 546 1.69e-3 SMART
ZnF_C2H2 552 574 9.73e-4 SMART
ZnF_C2H2 580 602 1.82e-3 SMART
ZnF_C2H2 608 630 3.16e-3 SMART
ZnF_C2H2 636 658 8.94e-3 SMART
ZnF_C2H2 664 686 3.74e-5 SMART
ZnF_C2H2 692 714 2.99e-4 SMART
ZnF_C2H2 720 742 5.21e-4 SMART
ZnF_C2H2 748 770 2.79e-4 SMART
ZnF_C2H2 776 798 1.58e-3 SMART
ZnF_C2H2 804 826 3.44e-4 SMART
ZnF_C2H2 832 854 5.59e-4 SMART
ZnF_C2H2 860 882 5.81e-2 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bap1 T C 14: 31,257,618 I526T possibly damaging Het
Calcr T C 6: 3,700,193 T263A possibly damaging Het
Cdh7 T A 1: 110,049,004 V133E probably benign Het
Ddx5 T C 11: 106,784,520 I330V probably benign Het
Dysf G A 6: 84,186,509 probably null Het
Gnl2 T C 4: 125,037,606 V110A probably damaging Het
H2-Q10 A G 17: 35,471,018 Y179C possibly damaging Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Map3k20 A G 2: 72,402,355 probably benign Het
Mcm7 G A 5: 138,164,736 R385W probably damaging Het
Mgat4c A G 10: 102,388,921 E332G probably benign Het
Nudt3 A G 17: 27,580,808 S134P possibly damaging Het
Olfr1186 A T 2: 88,526,365 T261S probably benign Het
Olfr1212 G T 2: 88,958,747 E94* probably null Het
Olfr385 C A 11: 73,589,013 G242C probably damaging Het
Olfr385 A T 11: 73,589,368 Y123* probably null Het
Olfr573-ps1 T C 7: 102,942,071 I169V probably benign Het
Pcnx A G 12: 81,996,118 T2325A probably benign Het
Plekha6 A G 1: 133,294,655 E993G probably damaging Het
Psmd4 T A 3: 95,036,728 Y15F probably benign Het
Rad23b C T 4: 55,382,586 T263M probably damaging Het
Stpg3 T A 2: 25,213,863 M154L probably benign Het
Vmn1r45 C A 6: 89,933,817 R57L probably benign Het
Other mutations in Zfp658
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Zfp658 APN 7 43567356 missense probably benign 0.03
IGL00475:Zfp658 APN 7 43574076 missense possibly damaging 0.68
IGL01972:Zfp658 APN 7 43572710 nonsense probably null
IGL03223:Zfp658 APN 7 43567311 missense possibly damaging 0.85
R0135:Zfp658 UTSW 7 43573595 nonsense probably null
R1863:Zfp658 UTSW 7 43573899 missense possibly damaging 0.78
R1962:Zfp658 UTSW 7 43573821 missense possibly damaging 0.93
R2698:Zfp658 UTSW 7 43573545 missense possibly damaging 0.53
R4791:Zfp658 UTSW 7 43574466 missense possibly damaging 0.93
R5392:Zfp658 UTSW 7 43572931 missense probably benign 0.07
R6092:Zfp658 UTSW 7 43574527 missense possibly damaging 0.73
R6594:Zfp658 UTSW 7 43567277 missense possibly damaging 0.86
R7003:Zfp658 UTSW 7 43574748 missense possibly damaging 0.85
R7008:Zfp658 UTSW 7 43573912 missense possibly damaging 0.95
R7077:Zfp658 UTSW 7 43573989 missense probably benign 0.32
R7689:Zfp658 UTSW 7 43574678 missense probably benign 0.00
R7793:Zfp658 UTSW 7 43574684 missense possibly damaging 0.74
R7939:Zfp658 UTSW 7 43574877 missense possibly damaging 0.73
Z1176:Zfp658 UTSW 7 43573217 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- AGCCTCACCGTTCACCAG -3'
(R):5'- GACCGTCAGCTGGGATGTG -3'

Sequencing Primer
(F):5'- CGTTCACCAGAAGATCCATATCAG -3'
(R):5'- TCAGCTGTGACCTCTGAAAG -3'
Posted On2015-03-25