Incidental Mutation 'R3781:H2-Q10'
ID272061
Institutional Source Beutler Lab
Gene Symbol H2-Q10
Ensembl Gene ENSMUSG00000067235
Gene Namehistocompatibility 2, Q region locus 10
SynonymsH-2Q10, Qa10, Q10
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3781 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location35470089-35474563 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 35471018 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 179 (Y179C)
Ref Sequence ENSEMBL: ENSMUSP00000134163 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068291] [ENSMUST00000174525]
Predicted Effect possibly damaging
Transcript: ENSMUST00000068291
AA Change: Y179C

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000066419
Gene: ENSMUSG00000067235
AA Change: Y179C

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
Pfam:MHC_I 25 203 5.8e-98 PFAM
IGc1 222 293 8.23e-23 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000174525
AA Change: Y179C

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000134163
Gene: ENSMUSG00000067235
AA Change: Y179C

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
Pfam:MHC_I 25 203 3.3e-99 PFAM
IGc1 222 293 8.23e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174589
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Unlike other class I genes, this gene is expressed only in liver cells and its product is secreted into the serum. The amount of protein in serum varies among inbred strains with different H2 haplotypes and is completely absent in the H2f strain B10.M. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bap1 T C 14: 31,257,618 I526T possibly damaging Het
Calcr T C 6: 3,700,193 T263A possibly damaging Het
Cdh7 T A 1: 110,049,004 V133E probably benign Het
Ddx5 T C 11: 106,784,520 I330V probably benign Het
Dysf G A 6: 84,186,509 probably null Het
Gnl2 T C 4: 125,037,606 V110A probably damaging Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Map3k20 A G 2: 72,402,355 probably benign Het
Mcm7 G A 5: 138,164,736 R385W probably damaging Het
Mgat4c A G 10: 102,388,921 E332G probably benign Het
Nudt3 A G 17: 27,580,808 S134P possibly damaging Het
Olfr1186 A T 2: 88,526,365 T261S probably benign Het
Olfr1212 G T 2: 88,958,747 E94* probably null Het
Olfr385 C A 11: 73,589,013 G242C probably damaging Het
Olfr385 A T 11: 73,589,368 Y123* probably null Het
Olfr573-ps1 T C 7: 102,942,071 I169V probably benign Het
Pcnx A G 12: 81,996,118 T2325A probably benign Het
Plekha6 A G 1: 133,294,655 E993G probably damaging Het
Psmd4 T A 3: 95,036,728 Y15F probably benign Het
Rad23b C T 4: 55,382,586 T263M probably damaging Het
Stpg3 T A 2: 25,213,863 M154L probably benign Het
Vmn1r45 C A 6: 89,933,817 R57L probably benign Het
Zfp658 G A 7: 43,573,846 R515H probably benign Het
Other mutations in H2-Q10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01893:H2-Q10 APN 17 35473271 missense probably damaging 1.00
IGL02003:H2-Q10 APN 17 35470441 missense probably benign 0.01
IGL02308:H2-Q10 APN 17 35473566 makesense probably null
IGL02804:H2-Q10 APN 17 35473250 missense probably damaging 1.00
gomez UTSW 17 35474020 utr 3 prime probably benign
lurch UTSW 17 35471018 missense possibly damaging 0.92
R0278:H2-Q10 UTSW 17 35473307 missense possibly damaging 0.83
R1679:H2-Q10 UTSW 17 35473595 utr 3 prime probably benign
R1919:H2-Q10 UTSW 17 35470488 missense probably damaging 1.00
R3782:H2-Q10 UTSW 17 35471018 missense possibly damaging 0.92
R4614:H2-Q10 UTSW 17 35474020 utr 3 prime probably benign
R4814:H2-Q10 UTSW 17 35473584 utr 3 prime probably benign
R4870:H2-Q10 UTSW 17 35470460 missense probably damaging 1.00
R6063:H2-Q10 UTSW 17 35470129 missense probably benign 0.13
R7448:H2-Q10 UTSW 17 35473560 missense not run
R7728:H2-Q10 UTSW 17 35470838 missense probably damaging 0.98
R8034:H2-Q10 UTSW 17 35470441 missense probably damaging 1.00
R8172:H2-Q10 UTSW 17 35471099 missense probably null 1.00
R8233:H2-Q10 UTSW 17 35471086 missense probably benign 0.28
R8400:H2-Q10 UTSW 17 35470477 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCCAGTGGATGTATGGCTG -3'
(R):5'- TCACTGTGATGAGGGATCAGG -3'

Sequencing Primer
(F):5'- CTGTAAAGTGGGGTCCGAC -3'
(R):5'- TCTGAGACAGGGGCATCAC -3'
Posted On2015-03-25