Incidental Mutation 'R3783:Ccdc93'
ID272104
Institutional Source Beutler Lab
Gene Symbol Ccdc93
Ensembl Gene ENSMUSG00000026339
Gene Namecoiled-coil domain containing 93
Synonyms
MMRRC Submission 040875-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.182) question?
Stock #R3783 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location121431049-121506460 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 121437869 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 77 (N77S)
Ref Sequence ENSEMBL: ENSMUSP00000108240 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036025] [ENSMUST00000112621]
Predicted Effect probably damaging
Transcript: ENSMUST00000036025
AA Change: N77S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000043442
Gene: ENSMUSG00000026339
AA Change: N77S

DomainStartEndE-ValueType
Pfam:KOG2701 27 206 2e-81 PFAM
coiled coil region 316 426 N/A INTRINSIC
coiled coil region 558 599 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112621
AA Change: N77S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108240
Gene: ENSMUSG00000026339
AA Change: N77S

DomainStartEndE-ValueType
Pfam:KOG2701 26 207 1.1e-86 PFAM
coiled coil region 231 269 N/A INTRINSIC
coiled coil region 315 425 N/A INTRINSIC
coiled coil region 557 598 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128924
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155673
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156459
Meta Mutation Damage Score 0.5648 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 98% (45/46)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Akap6 A G 12: 52,880,769 H154R probably damaging Het
Aoc1 T C 6: 48,905,655 L177P probably damaging Het
Ascc3 A G 10: 50,728,254 T1357A probably damaging Het
Atp13a3 A T 16: 30,354,249 V270D probably damaging Het
BC055324 A T 1: 163,987,683 C90S probably benign Het
Carmil3 T C 14: 55,496,976 F418S probably damaging Het
Cpt1b T C 15: 89,425,189 K47R probably damaging Het
Cyp4f14 A G 17: 32,916,762 Y42H probably benign Het
Dmxl1 G A 18: 49,865,122 S763N probably damaging Het
Fam129a C T 1: 151,689,648 S243L possibly damaging Het
Fancd2 T G 6: 113,565,204 S770A probably damaging Het
Flnb T G 14: 7,889,236 W529G probably benign Het
Fryl T C 5: 73,101,476 Y655C probably benign Het
Gml C T 15: 74,813,672 V155M probably damaging Het
Gpr174 A G X: 107,293,064 T161A probably benign Het
Heatr1 G T 13: 12,434,460 L1946F probably damaging Het
Inpp5k T C 11: 75,647,686 L461P probably damaging Het
Isy1 T C 6: 87,821,545 E209G possibly damaging Het
Kdm5b A G 1: 134,630,542 H1429R probably benign Het
Magi2 C T 5: 20,465,909 T580M probably damaging Het
Map3k1 C T 13: 111,756,220 V834I probably benign Het
Mdn1 A T 4: 32,720,818 E2310D probably benign Het
Myo15 A T 11: 60,477,572 Y386F probably damaging Het
Neurod1 T A 2: 79,454,595 N148I probably damaging Het
Nsa2 G T 13: 97,135,534 Q60K possibly damaging Het
Pcdha1 T A 18: 36,930,802 L173Q probably damaging Het
Pdpk1 T C 17: 24,110,850 T71A possibly damaging Het
Plxna2 T A 1: 194,807,521 V1692E probably damaging Het
Pmepa1 G A 2: 173,228,133 R210W probably damaging Het
Psg27 T A 7: 18,560,354 Q376L probably damaging Het
Psmd4 T C 3: 95,035,251 D6G possibly damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rala T A 13: 17,882,446 E185V probably benign Het
Sall4 A G 2: 168,756,123 S266P probably damaging Het
Scn10a T C 9: 119,691,562 T91A probably damaging Het
Synrg T C 11: 84,001,920 F613S probably damaging Het
Tekt1 A G 11: 72,344,894 I376T probably damaging Het
Tet2 T C 3: 133,479,363 K1182R possibly damaging Het
Thbs4 T C 13: 92,773,164 N375S probably benign Het
Thoc5 A G 11: 4,920,372 probably benign Het
Tmprss9 G T 10: 80,887,467 V254F probably damaging Het
Tro G A X: 150,655,052 T203I possibly damaging Het
Ttbk2 A T 2: 120,773,815 probably benign Het
Usf2 A G 7: 30,955,831 V133A probably benign Het
Wap G A 11: 6,638,550 Q25* probably null Het
Xdh C T 17: 73,893,595 probably benign Het
Xrn1 G T 9: 95,969,285 M153I probably benign Het
Other mutations in Ccdc93
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01524:Ccdc93 APN 1 121461899 missense probably benign 0.05
IGL01845:Ccdc93 APN 1 121463130 missense probably damaging 1.00
IGL02156:Ccdc93 APN 1 121448276 missense possibly damaging 0.88
IGL02610:Ccdc93 APN 1 121492971 missense probably benign 0.17
IGL02691:Ccdc93 APN 1 121486613 missense possibly damaging 0.80
IGL03003:Ccdc93 APN 1 121463117 missense possibly damaging 0.78
IGL02796:Ccdc93 UTSW 1 121491166 missense probably damaging 1.00
R0335:Ccdc93 UTSW 1 121492977 missense probably damaging 1.00
R1229:Ccdc93 UTSW 1 121434642 missense probably damaging 1.00
R1387:Ccdc93 UTSW 1 121491189 missense probably damaging 1.00
R1531:Ccdc93 UTSW 1 121480822 missense probably benign
R1559:Ccdc93 UTSW 1 121461983 splice site probably benign
R1728:Ccdc93 UTSW 1 121456126 missense probably benign
R1728:Ccdc93 UTSW 1 121461939 missense probably benign
R1729:Ccdc93 UTSW 1 121456126 missense probably benign
R1729:Ccdc93 UTSW 1 121461939 missense probably benign
R1730:Ccdc93 UTSW 1 121456126 missense probably benign
R1730:Ccdc93 UTSW 1 121461939 missense probably benign
R1739:Ccdc93 UTSW 1 121456126 missense probably benign
R1739:Ccdc93 UTSW 1 121461939 missense probably benign
R1762:Ccdc93 UTSW 1 121456126 missense probably benign
R1762:Ccdc93 UTSW 1 121461939 missense probably benign
R1783:Ccdc93 UTSW 1 121456126 missense probably benign
R1783:Ccdc93 UTSW 1 121461939 missense probably benign
R1785:Ccdc93 UTSW 1 121456126 missense probably benign
R1785:Ccdc93 UTSW 1 121461939 missense probably benign
R1865:Ccdc93 UTSW 1 121499227 missense probably damaging 0.98
R1897:Ccdc93 UTSW 1 121491212 missense probably benign 0.04
R2089:Ccdc93 UTSW 1 121483342 critical splice donor site probably null
R2091:Ccdc93 UTSW 1 121483342 critical splice donor site probably null
R2091:Ccdc93 UTSW 1 121483342 critical splice donor site probably null
R3820:Ccdc93 UTSW 1 121462240 missense probably damaging 0.99
R3870:Ccdc93 UTSW 1 121463114 missense probably benign 0.23
R5644:Ccdc93 UTSW 1 121483336 missense probably benign
R5896:Ccdc93 UTSW 1 121463120 missense possibly damaging 0.90
R6251:Ccdc93 UTSW 1 121434540 missense possibly damaging 0.70
R7765:Ccdc93 UTSW 1 121499313 missense probably damaging 1.00
R8017:Ccdc93 UTSW 1 121448264 missense probably damaging 1.00
R8019:Ccdc93 UTSW 1 121448264 missense probably damaging 1.00
X0063:Ccdc93 UTSW 1 121437806 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGATATTTATGGTTTTCTGAGCT -3'
(R):5'- CAGGAGAGACTACACGATGCT -3'

Sequencing Primer
(F):5'- CTGAGCTTTTTGAGTCTGTATGG -3'
(R):5'- TATATGGCAAGTTCCAGGCC -3'
Posted On2015-03-25