Incidental Mutation 'R3783:Neurod1'
ID272108
Institutional Source Beutler Lab
Gene Symbol Neurod1
Ensembl Gene ENSMUSG00000034701
Gene Nameneurogenic differentiation 1
SynonymsbHLHa3, BETA2, Neurod
MMRRC Submission 040875-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.926) question?
Stock #R3783 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location79452521-79456751 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 79454595 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 148 (N148I)
Ref Sequence ENSEMBL: ENSMUSP00000040364 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041099]
PDB Structure
Crystal Structure of the basic-helix-loop-helix domains of the heterodimer E47/NeuroD1 bound to DNA [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000041099
AA Change: N148I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040364
Gene: ENSMUSG00000034701
AA Change: N148I

DomainStartEndE-ValueType
coiled coil region 27 84 N/A INTRINSIC
HLH 107 159 9.63e-17 SMART
Pfam:Neuro_bHLH 160 284 1.1e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153602
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180703
Meta Mutation Damage Score 0.9036 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the NeuroD family of basic helix-loop-helix (bHLH) transcription factors. The protein forms heterodimers with other bHLH proteins and activates transcription of genes that contain a specific DNA sequence known as the E-box. It regulates expression of the insulin gene, and mutations in this gene result in type II diabetes mellitus. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit neonatal diabetes, pancreatic enteroendocrine cell deficits, impaired hearing and balance, retinal degeneration, and seizures. Survival past birth is dependent on genetic background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Akap6 A G 12: 52,880,769 H154R probably damaging Het
Aoc1 T C 6: 48,905,655 L177P probably damaging Het
Ascc3 A G 10: 50,728,254 T1357A probably damaging Het
Atp13a3 A T 16: 30,354,249 V270D probably damaging Het
BC055324 A T 1: 163,987,683 C90S probably benign Het
Carmil3 T C 14: 55,496,976 F418S probably damaging Het
Ccdc93 A G 1: 121,437,869 N77S probably damaging Het
Cpt1b T C 15: 89,425,189 K47R probably damaging Het
Cyp4f14 A G 17: 32,916,762 Y42H probably benign Het
Dmxl1 G A 18: 49,865,122 S763N probably damaging Het
Fam129a C T 1: 151,689,648 S243L possibly damaging Het
Fancd2 T G 6: 113,565,204 S770A probably damaging Het
Flnb T G 14: 7,889,236 W529G probably benign Het
Fryl T C 5: 73,101,476 Y655C probably benign Het
Gml C T 15: 74,813,672 V155M probably damaging Het
Gpr174 A G X: 107,293,064 T161A probably benign Het
Heatr1 G T 13: 12,434,460 L1946F probably damaging Het
Inpp5k T C 11: 75,647,686 L461P probably damaging Het
Isy1 T C 6: 87,821,545 E209G possibly damaging Het
Kdm5b A G 1: 134,630,542 H1429R probably benign Het
Magi2 C T 5: 20,465,909 T580M probably damaging Het
Map3k1 C T 13: 111,756,220 V834I probably benign Het
Mdn1 A T 4: 32,720,818 E2310D probably benign Het
Myo15 A T 11: 60,477,572 Y386F probably damaging Het
Nsa2 G T 13: 97,135,534 Q60K possibly damaging Het
Pcdha1 T A 18: 36,930,802 L173Q probably damaging Het
Pdpk1 T C 17: 24,110,850 T71A possibly damaging Het
Plxna2 T A 1: 194,807,521 V1692E probably damaging Het
Pmepa1 G A 2: 173,228,133 R210W probably damaging Het
Psg27 T A 7: 18,560,354 Q376L probably damaging Het
Psmd4 T C 3: 95,035,251 D6G possibly damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rala T A 13: 17,882,446 E185V probably benign Het
Sall4 A G 2: 168,756,123 S266P probably damaging Het
Scn10a T C 9: 119,691,562 T91A probably damaging Het
Synrg T C 11: 84,001,920 F613S probably damaging Het
Tekt1 A G 11: 72,344,894 I376T probably damaging Het
Tet2 T C 3: 133,479,363 K1182R possibly damaging Het
Thbs4 T C 13: 92,773,164 N375S probably benign Het
Thoc5 A G 11: 4,920,372 probably benign Het
Tmprss9 G T 10: 80,887,467 V254F probably damaging Het
Tro G A X: 150,655,052 T203I possibly damaging Het
Ttbk2 A T 2: 120,773,815 probably benign Het
Usf2 A G 7: 30,955,831 V133A probably benign Het
Wap G A 11: 6,638,550 Q25* probably null Het
Xdh C T 17: 73,893,595 probably benign Het
Xrn1 G T 9: 95,969,285 M153I probably benign Het
Other mutations in Neurod1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01558:Neurod1 APN 2 79454019 missense possibly damaging 0.85
IGL01814:Neurod1 APN 2 79454659 missense probably damaging 1.00
accelerando UTSW 2 79454026 missense probably benign 0.20
cruz UTSW 2 79454595 missense probably damaging 1.00
R0427:Neurod1 UTSW 2 79454182 missense probably damaging 1.00
R1775:Neurod1 UTSW 2 79454437 missense probably benign 0.10
R1795:Neurod1 UTSW 2 79454329 missense probably benign 0.13
R3785:Neurod1 UTSW 2 79454595 missense probably damaging 1.00
R3786:Neurod1 UTSW 2 79454595 missense probably damaging 1.00
R3787:Neurod1 UTSW 2 79454595 missense probably damaging 1.00
R4031:Neurod1 UTSW 2 79454026 missense probably benign 0.20
R4978:Neurod1 UTSW 2 79454227 missense probably damaging 1.00
R6163:Neurod1 UTSW 2 79454161 missense probably benign 0.00
R7098:Neurod1 UTSW 2 79454685 missense probably damaging 1.00
R7401:Neurod1 UTSW 2 79454946 missense probably benign 0.14
R7576:Neurod1 UTSW 2 79454345 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGGCTTTCAAAGAAGGGCTC -3'
(R):5'- AGGACGAGCTTGAAGCCATG -3'

Sequencing Primer
(F):5'- CTTTCAAAGAAGGGCTCCAGAG -3'
(R):5'- CGAGCTTGAAGCCATGAATGC -3'
Posted On2015-03-25