Incidental Mutation 'R3783:Psmd4'
ID272112
Institutional Source Beutler Lab
Gene Symbol Psmd4
Ensembl Gene ENSMUSG00000005625
Gene Nameproteasome (prosome, macropain) 26S subunit, non-ATPase, 4
SynonymsAf1, multiubiquitin-chain-binding protein, Mcb1, angiocidin
MMRRC Submission 040875-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3783 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location95032694-95042614 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 95035251 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 6 (D6G)
Ref Sequence ENSEMBL: ENSMUSP00000114545 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071664] [ENSMUST00000107237] [ENSMUST00000117355] [ENSMUST00000140348]
Predicted Effect probably benign
Transcript: ENSMUST00000071664
AA Change: D119G

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000071589
Gene: ENSMUSG00000005625
AA Change: D119G

DomainStartEndE-ValueType
VWA 2 188 7.38e-12 SMART
low complexity region 189 201 N/A INTRINSIC
UIM 211 230 2.04e0 SMART
UIM 285 304 1.49e-2 SMART
low complexity region 307 320 N/A INTRINSIC
low complexity region 367 379 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107237
AA Change: D119G

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000102857
Gene: ENSMUSG00000005625
AA Change: D119G

DomainStartEndE-ValueType
VWA 2 188 7.38e-12 SMART
low complexity region 189 201 N/A INTRINSIC
UIM 211 230 2.04e0 SMART
UIM 282 301 1.49e-2 SMART
low complexity region 304 317 N/A INTRINSIC
low complexity region 364 376 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117355
AA Change: D119G

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000113554
Gene: ENSMUSG00000005625
AA Change: D119G

DomainStartEndE-ValueType
VWA 2 188 7.38e-12 SMART
low complexity region 189 201 N/A INTRINSIC
UIM 211 230 2.04e0 SMART
UIM 285 304 1.49e-2 SMART
low complexity region 307 320 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136868
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140280
Predicted Effect possibly damaging
Transcript: ENSMUST00000140348
AA Change: D6G

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000114545
Gene: ENSMUSG00000005625
AA Change: D6G

DomainStartEndE-ValueType
Pfam:UIM 34 42 2.4e-3 PFAM
UIM 100 119 1.49e-2 SMART
low complexity region 122 135 N/A INTRINSIC
low complexity region 182 194 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143688
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147960
Meta Mutation Damage Score 0.0826 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes one of the non-ATPase subunits of the 19S regulator lid. Pseudogenes have been identified on chromosomes 10 and 21. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality and abnormal embryogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Akap6 A G 12: 52,880,769 H154R probably damaging Het
Aoc1 T C 6: 48,905,655 L177P probably damaging Het
Ascc3 A G 10: 50,728,254 T1357A probably damaging Het
Atp13a3 A T 16: 30,354,249 V270D probably damaging Het
BC055324 A T 1: 163,987,683 C90S probably benign Het
Carmil3 T C 14: 55,496,976 F418S probably damaging Het
Ccdc93 A G 1: 121,437,869 N77S probably damaging Het
Cpt1b T C 15: 89,425,189 K47R probably damaging Het
Cyp4f14 A G 17: 32,916,762 Y42H probably benign Het
Dmxl1 G A 18: 49,865,122 S763N probably damaging Het
Fam129a C T 1: 151,689,648 S243L possibly damaging Het
Fancd2 T G 6: 113,565,204 S770A probably damaging Het
Flnb T G 14: 7,889,236 W529G probably benign Het
Fryl T C 5: 73,101,476 Y655C probably benign Het
Gml C T 15: 74,813,672 V155M probably damaging Het
Gpr174 A G X: 107,293,064 T161A probably benign Het
Heatr1 G T 13: 12,434,460 L1946F probably damaging Het
Inpp5k T C 11: 75,647,686 L461P probably damaging Het
Isy1 T C 6: 87,821,545 E209G possibly damaging Het
Kdm5b A G 1: 134,630,542 H1429R probably benign Het
Magi2 C T 5: 20,465,909 T580M probably damaging Het
Map3k1 C T 13: 111,756,220 V834I probably benign Het
Mdn1 A T 4: 32,720,818 E2310D probably benign Het
Myo15 A T 11: 60,477,572 Y386F probably damaging Het
Neurod1 T A 2: 79,454,595 N148I probably damaging Het
Nsa2 G T 13: 97,135,534 Q60K possibly damaging Het
Pcdha1 T A 18: 36,930,802 L173Q probably damaging Het
Pdpk1 T C 17: 24,110,850 T71A possibly damaging Het
Plxna2 T A 1: 194,807,521 V1692E probably damaging Het
Pmepa1 G A 2: 173,228,133 R210W probably damaging Het
Psg27 T A 7: 18,560,354 Q376L probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rala T A 13: 17,882,446 E185V probably benign Het
Sall4 A G 2: 168,756,123 S266P probably damaging Het
Scn10a T C 9: 119,691,562 T91A probably damaging Het
Synrg T C 11: 84,001,920 F613S probably damaging Het
Tekt1 A G 11: 72,344,894 I376T probably damaging Het
Tet2 T C 3: 133,479,363 K1182R possibly damaging Het
Thbs4 T C 13: 92,773,164 N375S probably benign Het
Thoc5 A G 11: 4,920,372 probably benign Het
Tmprss9 G T 10: 80,887,467 V254F probably damaging Het
Tro G A X: 150,655,052 T203I possibly damaging Het
Ttbk2 A T 2: 120,773,815 probably benign Het
Usf2 A G 7: 30,955,831 V133A probably benign Het
Wap G A 11: 6,638,550 Q25* probably null Het
Xdh C T 17: 73,893,595 probably benign Het
Xrn1 G T 9: 95,969,285 M153I probably benign Het
Other mutations in Psmd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02396:Psmd4 APN 3 95035910 missense probably damaging 1.00
R0173:Psmd4 UTSW 3 95032923 missense probably damaging 1.00
R1962:Psmd4 UTSW 3 95036701 missense possibly damaging 0.89
R2907:Psmd4 UTSW 3 95033962 missense probably damaging 0.99
R3781:Psmd4 UTSW 3 95036728 missense probably benign 0.09
R4902:Psmd4 UTSW 3 95035859 missense probably damaging 0.98
R5090:Psmd4 UTSW 3 95035248 missense possibly damaging 0.53
R8031:Psmd4 UTSW 3 95035892 missense probably damaging 1.00
X0024:Psmd4 UTSW 3 95036717 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGCCTCACAGACGCATACAG -3'
(R):5'- GTCCACTTGAGGCACAACAG -3'

Sequencing Primer
(F):5'- GAAATTCAGCATCCTACCAAAGGTC -3'
(R):5'- CATGTACCGAGTGAGCATTATG -3'
Posted On2015-03-25