Incidental Mutation 'R3783:Usf2'
ID272121
Institutional Source Beutler Lab
Gene Symbol Usf2
Ensembl Gene ENSMUSG00000058239
Gene Nameupstream transcription factor 2
SynonymsUsf-2, bHLHb12
MMRRC Submission 040875-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.754) question?
Stock #R3783 (G1)
Quality Score89
Status Not validated
Chromosome7
Chromosomal Location30945248-30956803 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30955831 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 133 (V133A)
Ref Sequence ENSEMBL: ENSMUSP00000132256 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001279] [ENSMUST00000058860] [ENSMUST00000098553] [ENSMUST00000108116] [ENSMUST00000108119] [ENSMUST00000147431] [ENSMUST00000162228] [ENSMUST00000170699] [ENSMUST00000172417] [ENSMUST00000205961]
Predicted Effect probably benign
Transcript: ENSMUST00000001279
SMART Domains Protein: ENSMUSP00000001279
Gene: ENSMUSG00000001247

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
IG 43 186 1.23e-3 SMART
Pfam:LSR 206 253 9.6e-27 PFAM
low complexity region 280 296 N/A INTRINSIC
low complexity region 445 464 N/A INTRINSIC
low complexity region 468 487 N/A INTRINSIC
low complexity region 496 513 N/A INTRINSIC
low complexity region 544 558 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000058860
AA Change: V133A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000132256
Gene: ENSMUSG00000058239
AA Change: V133A

DomainStartEndE-ValueType
low complexity region 11 21 N/A INTRINSIC
low complexity region 86 110 N/A INTRINSIC
HLH 241 296 1.36e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098553
SMART Domains Protein: ENSMUSP00000096153
Gene: ENSMUSG00000001247

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
IG 43 186 1.23e-3 SMART
low complexity region 212 228 N/A INTRINSIC
low complexity region 377 396 N/A INTRINSIC
low complexity region 400 419 N/A INTRINSIC
low complexity region 428 445 N/A INTRINSIC
low complexity region 476 490 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108116
SMART Domains Protein: ENSMUSP00000103751
Gene: ENSMUSG00000001247

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
IG 43 186 1.23e-3 SMART
Pfam:LSR 187 235 2.3e-25 PFAM
low complexity region 261 277 N/A INTRINSIC
low complexity region 426 445 N/A INTRINSIC
low complexity region 449 468 N/A INTRINSIC
low complexity region 477 494 N/A INTRINSIC
low complexity region 525 539 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108119
SMART Domains Protein: ENSMUSP00000132021
Gene: ENSMUSG00000058239

DomainStartEndE-ValueType
low complexity region 11 21 N/A INTRINSIC
HLH 174 229 1.36e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133179
Predicted Effect probably benign
Transcript: ENSMUST00000147431
SMART Domains Protein: ENSMUSP00000123487
Gene: ENSMUSG00000001247

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
low complexity region 65 81 N/A INTRINSIC
low complexity region 230 249 N/A INTRINSIC
low complexity region 253 272 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162228
SMART Domains Protein: ENSMUSP00000125520
Gene: ENSMUSG00000058239

DomainStartEndE-ValueType
low complexity region 11 21 N/A INTRINSIC
low complexity region 86 110 N/A INTRINSIC
HLH 214 269 1.36e-16 SMART
Predicted Effect unknown
Transcript: ENSMUST00000166340
AA Change: V25A
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167285
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168731
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169496
Predicted Effect unknown
Transcript: ENSMUST00000170442
AA Change: V87A
SMART Domains Protein: ENSMUSP00000130298
Gene: ENSMUSG00000058239
AA Change: V87A

DomainStartEndE-ValueType
low complexity region 41 65 N/A INTRINSIC
HLH 196 243 1.83e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170699
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171338
Predicted Effect probably benign
Transcript: ENSMUST00000172417
SMART Domains Protein: ENSMUSP00000132833
Gene: ENSMUSG00000058239

DomainStartEndE-ValueType
low complexity region 11 21 N/A INTRINSIC
HLH 110 165 1.36e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181395
Predicted Effect probably benign
Transcript: ENSMUST00000205961
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206345
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the basic helix-loop-helix leucine zipper family of transcription factors. The encoded protein can activate transcription through pyrimidine-rich initiator (Inr) elements and E-box motifs and is involved in regulating multiple cellular processes. [provided by RefSeq, Mar 2016]
PHENOTYPE: Homozygous null mutants are 20-40% smaller at birth and > 50% die postnatally, possibly because they are unable to nurse. In survivors, a proportionate dwarfism is maintained into adulthood. Males are usually infertile and die before 6 months of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Akap6 A G 12: 52,880,769 H154R probably damaging Het
Aoc1 T C 6: 48,905,655 L177P probably damaging Het
Ascc3 A G 10: 50,728,254 T1357A probably damaging Het
Atp13a3 A T 16: 30,354,249 V270D probably damaging Het
BC055324 A T 1: 163,987,683 C90S probably benign Het
Carmil3 T C 14: 55,496,976 F418S probably damaging Het
Ccdc93 A G 1: 121,437,869 N77S probably damaging Het
Cpt1b T C 15: 89,425,189 K47R probably damaging Het
Cyp4f14 A G 17: 32,916,762 Y42H probably benign Het
Dmxl1 G A 18: 49,865,122 S763N probably damaging Het
Fam129a C T 1: 151,689,648 S243L possibly damaging Het
Fancd2 T G 6: 113,565,204 S770A probably damaging Het
Flnb T G 14: 7,889,236 W529G probably benign Het
Fryl T C 5: 73,101,476 Y655C probably benign Het
Gml C T 15: 74,813,672 V155M probably damaging Het
Gpr174 A G X: 107,293,064 T161A probably benign Het
Heatr1 G T 13: 12,434,460 L1946F probably damaging Het
Inpp5k T C 11: 75,647,686 L461P probably damaging Het
Isy1 T C 6: 87,821,545 E209G possibly damaging Het
Kdm5b A G 1: 134,630,542 H1429R probably benign Het
Magi2 C T 5: 20,465,909 T580M probably damaging Het
Map3k1 C T 13: 111,756,220 V834I probably benign Het
Mdn1 A T 4: 32,720,818 E2310D probably benign Het
Myo15 A T 11: 60,477,572 Y386F probably damaging Het
Neurod1 T A 2: 79,454,595 N148I probably damaging Het
Nsa2 G T 13: 97,135,534 Q60K possibly damaging Het
Pcdha1 T A 18: 36,930,802 L173Q probably damaging Het
Pdpk1 T C 17: 24,110,850 T71A possibly damaging Het
Plxna2 T A 1: 194,807,521 V1692E probably damaging Het
Pmepa1 G A 2: 173,228,133 R210W probably damaging Het
Psg27 T A 7: 18,560,354 Q376L probably damaging Het
Psmd4 T C 3: 95,035,251 D6G possibly damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rala T A 13: 17,882,446 E185V probably benign Het
Sall4 A G 2: 168,756,123 S266P probably damaging Het
Scn10a T C 9: 119,691,562 T91A probably damaging Het
Synrg T C 11: 84,001,920 F613S probably damaging Het
Tekt1 A G 11: 72,344,894 I376T probably damaging Het
Tet2 T C 3: 133,479,363 K1182R possibly damaging Het
Thbs4 T C 13: 92,773,164 N375S probably benign Het
Thoc5 A G 11: 4,920,372 probably benign Het
Tmprss9 G T 10: 80,887,467 V254F probably damaging Het
Tro G A X: 150,655,052 T203I possibly damaging Het
Ttbk2 A T 2: 120,773,815 probably benign Het
Wap G A 11: 6,638,550 Q25* probably null Het
Xdh C T 17: 73,893,595 probably benign Het
Xrn1 G T 9: 95,969,285 M153I probably benign Het
Other mutations in Usf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02756:Usf2 APN 7 30946992 nonsense probably null
IGL02990:Usf2 APN 7 30955307 missense probably benign
R0332:Usf2 UTSW 7 30955179 missense possibly damaging 0.95
R0513:Usf2 UTSW 7 30954736 unclassified probably benign
R1827:Usf2 UTSW 7 30955340 missense probably damaging 0.96
R1946:Usf2 UTSW 7 30956238 missense probably null
R2190:Usf2 UTSW 7 30955181 missense probably damaging 1.00
R4744:Usf2 UTSW 7 30954772 missense probably damaging 1.00
R6372:Usf2 UTSW 7 30955313 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCTCTGACACCATTCAACCATCATTAG -3'
(R):5'- TGACATACCGCGTAGTCCAG -3'

Sequencing Primer
(F):5'- CCAGTTTTGCAATGAAAAGTAACTCC -3'
(R):5'- ATACCGCGTAGTCCAGGTGAC -3'
Posted On2015-03-25