Incidental Mutation 'R3783:Inpp5k'
ID272130
Institutional Source Beutler Lab
Gene Symbol Inpp5k
Ensembl Gene ENSMUSG00000006127
Gene Nameinositol polyphosphate 5-phosphatase K
Synonymsputative PI-5-phosphatase, PI-5-phosphatase related, C62, Pps
MMRRC Submission 040875-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3783 (G1)
Quality Score202
Status Validated
Chromosome11
Chromosomal Location75630988-75648871 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75647686 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 461 (L461P)
Ref Sequence ENSEMBL: ENSMUSP00000006286 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006286] [ENSMUST00000069057] [ENSMUST00000102504] [ENSMUST00000102505] [ENSMUST00000139856] [ENSMUST00000150857]
Predicted Effect probably damaging
Transcript: ENSMUST00000006286
AA Change: L461P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000006286
Gene: ENSMUSG00000006127
AA Change: L461P

DomainStartEndE-ValueType
IPPc 30 345 1.03e-148 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000069057
SMART Domains Protein: ENSMUSP00000070388
Gene: ENSMUSG00000017774

DomainStartEndE-ValueType
MYSc 5 697 N/A SMART
IQ 698 720 3.85e-3 SMART
IQ 721 743 2.09e-4 SMART
Blast:MYSc 751 780 5e-9 BLAST
low complexity region 804 815 N/A INTRINSIC
Pfam:Myosin_TH1 838 1024 1.9e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102504
SMART Domains Protein: ENSMUSP00000099562
Gene: ENSMUSG00000017774

DomainStartEndE-ValueType
MYSc 5 697 N/A SMART
IQ 698 720 3.85e-3 SMART
IQ 721 743 2.09e-4 SMART
Blast:MYSc 751 780 5e-9 BLAST
low complexity region 804 815 N/A INTRINSIC
Pfam:Myosin_TH1 838 1024 1.9e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102505
SMART Domains Protein: ENSMUSP00000099563
Gene: ENSMUSG00000017774

DomainStartEndE-ValueType
MYSc 40 732 N/A SMART
IQ 733 755 3.85e-3 SMART
IQ 756 778 2.09e-4 SMART
Blast:MYSc 786 815 6e-9 BLAST
low complexity region 839 850 N/A INTRINSIC
Pfam:Myosin_TH1 874 1052 2.9e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130318
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136605
Predicted Effect probably damaging
Transcript: ENSMUST00000139856
AA Change: L105P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000121060
Gene: ENSMUSG00000006127
AA Change: L105P

DomainStartEndE-ValueType
Blast:IPPc 18 94 4e-8 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149134
Predicted Effect probably benign
Transcript: ENSMUST00000150857
Meta Mutation Damage Score 0.1822 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with 5-phosphatase activity toward polyphosphate inositol. The protein localizes to the cytosol in regions lacking actin stress fibers. It is thought that this protein may negatively regulate the actin cytoskeleton. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous disruption of this gene leads to embryonic lethality. Adult heterozygous mutant mice show normal food intake and adiposity but exhibit enhanced glucose homeostasis and insulin sensitivity, increased insulin action in skeletal muscle, and reduced diet-induced obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Akap6 A G 12: 52,880,769 H154R probably damaging Het
Aoc1 T C 6: 48,905,655 L177P probably damaging Het
Ascc3 A G 10: 50,728,254 T1357A probably damaging Het
Atp13a3 A T 16: 30,354,249 V270D probably damaging Het
BC055324 A T 1: 163,987,683 C90S probably benign Het
Carmil3 T C 14: 55,496,976 F418S probably damaging Het
Ccdc93 A G 1: 121,437,869 N77S probably damaging Het
Cpt1b T C 15: 89,425,189 K47R probably damaging Het
Cyp4f14 A G 17: 32,916,762 Y42H probably benign Het
Dmxl1 G A 18: 49,865,122 S763N probably damaging Het
Fam129a C T 1: 151,689,648 S243L possibly damaging Het
Fancd2 T G 6: 113,565,204 S770A probably damaging Het
Flnb T G 14: 7,889,236 W529G probably benign Het
Fryl T C 5: 73,101,476 Y655C probably benign Het
Gml C T 15: 74,813,672 V155M probably damaging Het
Gpr174 A G X: 107,293,064 T161A probably benign Het
Heatr1 G T 13: 12,434,460 L1946F probably damaging Het
Isy1 T C 6: 87,821,545 E209G possibly damaging Het
Kdm5b A G 1: 134,630,542 H1429R probably benign Het
Magi2 C T 5: 20,465,909 T580M probably damaging Het
Map3k1 C T 13: 111,756,220 V834I probably benign Het
Mdn1 A T 4: 32,720,818 E2310D probably benign Het
Myo15 A T 11: 60,477,572 Y386F probably damaging Het
Neurod1 T A 2: 79,454,595 N148I probably damaging Het
Nsa2 G T 13: 97,135,534 Q60K possibly damaging Het
Pcdha1 T A 18: 36,930,802 L173Q probably damaging Het
Pdpk1 T C 17: 24,110,850 T71A possibly damaging Het
Plxna2 T A 1: 194,807,521 V1692E probably damaging Het
Pmepa1 G A 2: 173,228,133 R210W probably damaging Het
Psg27 T A 7: 18,560,354 Q376L probably damaging Het
Psmd4 T C 3: 95,035,251 D6G possibly damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rala T A 13: 17,882,446 E185V probably benign Het
Sall4 A G 2: 168,756,123 S266P probably damaging Het
Scn10a T C 9: 119,691,562 T91A probably damaging Het
Synrg T C 11: 84,001,920 F613S probably damaging Het
Tekt1 A G 11: 72,344,894 I376T probably damaging Het
Tet2 T C 3: 133,479,363 K1182R possibly damaging Het
Thbs4 T C 13: 92,773,164 N375S probably benign Het
Thoc5 A G 11: 4,920,372 probably benign Het
Tmprss9 G T 10: 80,887,467 V254F probably damaging Het
Tro G A X: 150,655,052 T203I possibly damaging Het
Ttbk2 A T 2: 120,773,815 probably benign Het
Usf2 A G 7: 30,955,831 V133A probably benign Het
Wap G A 11: 6,638,550 Q25* probably null Het
Xdh C T 17: 73,893,595 probably benign Het
Xrn1 G T 9: 95,969,285 M153I probably benign Het
Other mutations in Inpp5k
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Inpp5k APN 11 75646820 missense possibly damaging 0.72
IGL00470:Inpp5k APN 11 75645525 missense probably benign 0.00
IGL00529:Inpp5k APN 11 75631204 unclassified probably benign
IGL01761:Inpp5k APN 11 75647677 missense possibly damaging 0.75
IGL02532:Inpp5k APN 11 75633184 unclassified probably benign
R0081:Inpp5k UTSW 11 75631147 frame shift probably null
R0206:Inpp5k UTSW 11 75631143 missense probably benign
R0206:Inpp5k UTSW 11 75631143 missense probably benign
R0520:Inpp5k UTSW 11 75639530 nonsense probably null
R0841:Inpp5k UTSW 11 75633459 unclassified probably benign
R1145:Inpp5k UTSW 11 75633459 unclassified probably benign
R1433:Inpp5k UTSW 11 75637491 missense probably benign 0.00
R1605:Inpp5k UTSW 11 75633481 missense probably benign 0.00
R2144:Inpp5k UTSW 11 75647191 critical splice acceptor site probably null
R2145:Inpp5k UTSW 11 75647191 critical splice acceptor site probably null
R2296:Inpp5k UTSW 11 75639487 missense probably damaging 1.00
R3784:Inpp5k UTSW 11 75647686 missense probably damaging 0.99
R3785:Inpp5k UTSW 11 75647686 missense probably damaging 0.99
R3787:Inpp5k UTSW 11 75647686 missense probably damaging 0.99
R5999:Inpp5k UTSW 11 75633100 missense probably damaging 0.99
R6337:Inpp5k UTSW 11 75646814 missense probably damaging 1.00
R6405:Inpp5k UTSW 11 75633178 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CCCTTCAAGGTAAGGGGTTG -3'
(R):5'- ATTAAAGGGCCAGTTCCTCTG -3'

Sequencing Primer
(F):5'- CTTCAAGGTAAGGGGTTGCTGTTG -3'
(R):5'- AGGAGTCTAGCTGAGCTCCTCTG -3'
Posted On2015-03-25