Incidental Mutation 'R3783:Akap6'
ID272133
Institutional Source Beutler Lab
Gene Symbol Akap6
Ensembl Gene ENSMUSG00000061603
Gene NameA kinase (PRKA) anchor protein 6
Synonyms
MMRRC Submission 040875-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.698) question?
Stock #R3783 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location52699383-53155599 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 52880769 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 154 (H154R)
Ref Sequence ENSEMBL: ENSMUSP00000151871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095737] [ENSMUST00000219786]
Predicted Effect probably damaging
Transcript: ENSMUST00000095737
AA Change: H154R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093406
Gene: ENSMUSG00000061603
AA Change: H154R

DomainStartEndE-ValueType
low complexity region 34 51 N/A INTRINSIC
Blast:SPEC 66 168 2e-50 BLAST
low complexity region 441 455 N/A INTRINSIC
low complexity region 544 555 N/A INTRINSIC
low complexity region 569 587 N/A INTRINSIC
low complexity region 640 651 N/A INTRINSIC
low complexity region 694 708 N/A INTRINSIC
SPEC 779 880 1.06e-1 SMART
SPEC 959 1057 1.45e0 SMART
SPEC 1078 1185 2.56e-2 SMART
low complexity region 1316 1332 N/A INTRINSIC
low complexity region 1555 1568 N/A INTRINSIC
low complexity region 1610 1622 N/A INTRINSIC
low complexity region 1683 1698 N/A INTRINSIC
low complexity region 1737 1781 N/A INTRINSIC
low complexity region 1899 1910 N/A INTRINSIC
low complexity region 2019 2031 N/A INTRINSIC
low complexity region 2104 2115 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000219786
AA Change: H154R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.3225 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins, which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. The encoded protein is highly expressed in various brain regions and cardiac and skeletal muscle. It is specifically localized to the sarcoplasmic reticulum and nuclear membrane, and is involved in anchoring PKA to the nuclear membrane or sarcoplasmic reticulum. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted disruption of this gene results in partial embryonic lethality; surviving homozygotes display a decreased body weight, craniofacial defects and reduced viability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Aoc1 T C 6: 48,905,655 L177P probably damaging Het
Ascc3 A G 10: 50,728,254 T1357A probably damaging Het
Atp13a3 A T 16: 30,354,249 V270D probably damaging Het
BC055324 A T 1: 163,987,683 C90S probably benign Het
Carmil3 T C 14: 55,496,976 F418S probably damaging Het
Ccdc93 A G 1: 121,437,869 N77S probably damaging Het
Cpt1b T C 15: 89,425,189 K47R probably damaging Het
Cyp4f14 A G 17: 32,916,762 Y42H probably benign Het
Dmxl1 G A 18: 49,865,122 S763N probably damaging Het
Fam129a C T 1: 151,689,648 S243L possibly damaging Het
Fancd2 T G 6: 113,565,204 S770A probably damaging Het
Flnb T G 14: 7,889,236 W529G probably benign Het
Fryl T C 5: 73,101,476 Y655C probably benign Het
Gml C T 15: 74,813,672 V155M probably damaging Het
Gpr174 A G X: 107,293,064 T161A probably benign Het
Heatr1 G T 13: 12,434,460 L1946F probably damaging Het
Inpp5k T C 11: 75,647,686 L461P probably damaging Het
Isy1 T C 6: 87,821,545 E209G possibly damaging Het
Kdm5b A G 1: 134,630,542 H1429R probably benign Het
Magi2 C T 5: 20,465,909 T580M probably damaging Het
Map3k1 C T 13: 111,756,220 V834I probably benign Het
Mdn1 A T 4: 32,720,818 E2310D probably benign Het
Myo15 A T 11: 60,477,572 Y386F probably damaging Het
Neurod1 T A 2: 79,454,595 N148I probably damaging Het
Nsa2 G T 13: 97,135,534 Q60K possibly damaging Het
Pcdha1 T A 18: 36,930,802 L173Q probably damaging Het
Pdpk1 T C 17: 24,110,850 T71A possibly damaging Het
Plxna2 T A 1: 194,807,521 V1692E probably damaging Het
Pmepa1 G A 2: 173,228,133 R210W probably damaging Het
Psg27 T A 7: 18,560,354 Q376L probably damaging Het
Psmd4 T C 3: 95,035,251 D6G possibly damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rala T A 13: 17,882,446 E185V probably benign Het
Sall4 A G 2: 168,756,123 S266P probably damaging Het
Scn10a T C 9: 119,691,562 T91A probably damaging Het
Synrg T C 11: 84,001,920 F613S probably damaging Het
Tekt1 A G 11: 72,344,894 I376T probably damaging Het
Tet2 T C 3: 133,479,363 K1182R possibly damaging Het
Thbs4 T C 13: 92,773,164 N375S probably benign Het
Thoc5 A G 11: 4,920,372 probably benign Het
Tmprss9 G T 10: 80,887,467 V254F probably damaging Het
Tro G A X: 150,655,052 T203I possibly damaging Het
Ttbk2 A T 2: 120,773,815 probably benign Het
Usf2 A G 7: 30,955,831 V133A probably benign Het
Wap G A 11: 6,638,550 Q25* probably null Het
Xdh C T 17: 73,893,595 probably benign Het
Xrn1 G T 9: 95,969,285 M153I probably benign Het
Other mutations in Akap6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Akap6 APN 12 53140980 missense possibly damaging 0.79
IGL00505:Akap6 APN 12 52887102 missense possibly damaging 0.92
IGL01134:Akap6 APN 12 52937217 missense probably damaging 0.96
IGL01458:Akap6 APN 12 52886818 nonsense probably null
IGL01589:Akap6 APN 12 53139664 missense probably damaging 1.00
IGL01592:Akap6 APN 12 53142142 missense probably damaging 1.00
IGL01738:Akap6 APN 12 52886817 missense probably damaging 0.99
IGL01867:Akap6 APN 12 52888008 missense probably damaging 1.00
IGL02025:Akap6 APN 12 53140335 missense probably benign
IGL02041:Akap6 APN 12 53140653 missense probably damaging 1.00
IGL02058:Akap6 APN 12 53140555 missense probably damaging 1.00
IGL02194:Akap6 APN 12 52886823 missense probably benign 0.00
IGL02226:Akap6 APN 12 53010467 splice site probably benign
IGL02323:Akap6 APN 12 53140429 missense probably benign 0.00
IGL02449:Akap6 APN 12 53140188 missense probably damaging 1.00
IGL02475:Akap6 APN 12 53139494 missense probably benign 0.03
IGL02546:Akap6 APN 12 52880738 missense probably damaging 1.00
IGL02547:Akap6 APN 12 53140696 missense probably damaging 1.00
IGL02588:Akap6 APN 12 52886499 nonsense probably null
IGL02608:Akap6 APN 12 53010606 missense probably benign 0.39
IGL02884:Akap6 APN 12 52886622 missense probably benign 0.00
IGL02945:Akap6 APN 12 52880837 missense probably damaging 1.00
IGL03029:Akap6 APN 12 52886412 missense probably damaging 1.00
IGL03129:Akap6 APN 12 53140306 missense probably damaging 1.00
R0133:Akap6 UTSW 12 53139471 nonsense probably null
R0166:Akap6 UTSW 12 53140924 missense probably benign 0.04
R0189:Akap6 UTSW 12 53141254 missense probably benign 0.41
R0532:Akap6 UTSW 12 52887983 missense probably benign 0.00
R0632:Akap6 UTSW 12 52937148 missense probably damaging 1.00
R0666:Akap6 UTSW 12 52911808 missense probably damaging 1.00
R0723:Akap6 UTSW 12 53141902 missense probably damaging 1.00
R0763:Akap6 UTSW 12 53142214 missense possibly damaging 0.93
R0785:Akap6 UTSW 12 52886622 missense probably benign 0.00
R0879:Akap6 UTSW 12 52880799 missense probably damaging 1.00
R0880:Akap6 UTSW 12 53139508 missense possibly damaging 0.93
R1033:Akap6 UTSW 12 53069222 missense probably damaging 0.97
R1055:Akap6 UTSW 12 52880672 nonsense probably null
R1199:Akap6 UTSW 12 52796190 missense probably damaging 1.00
R1295:Akap6 UTSW 12 52887029 missense probably damaging 1.00
R1389:Akap6 UTSW 12 53139520 missense probably benign 0.15
R1471:Akap6 UTSW 12 53141496 missense probably benign 0.05
R1483:Akap6 UTSW 12 52796087 missense probably damaging 1.00
R1512:Akap6 UTSW 12 52937154 missense probably damaging 1.00
R1648:Akap6 UTSW 12 53142006 nonsense probably null
R1791:Akap6 UTSW 12 53069125 missense probably damaging 1.00
R1888:Akap6 UTSW 12 53142175 missense possibly damaging 0.88
R1888:Akap6 UTSW 12 53142175 missense possibly damaging 0.88
R1891:Akap6 UTSW 12 53142175 missense possibly damaging 0.88
R1899:Akap6 UTSW 12 53141852 missense possibly damaging 0.95
R1917:Akap6 UTSW 12 53104612 missense probably benign 0.13
R1970:Akap6 UTSW 12 52938475 missense probably damaging 0.96
R1987:Akap6 UTSW 12 53140795 missense possibly damaging 0.78
R1988:Akap6 UTSW 12 53140795 missense possibly damaging 0.78
R2153:Akap6 UTSW 12 53141404 missense probably benign 0.03
R2567:Akap6 UTSW 12 52938373 missense probably damaging 1.00
R2568:Akap6 UTSW 12 52887278 missense possibly damaging 0.77
R3025:Akap6 UTSW 12 53140143 missense probably benign
R3051:Akap6 UTSW 12 52887033 missense probably damaging 1.00
R3195:Akap6 UTSW 12 53072457 nonsense probably null
R3196:Akap6 UTSW 12 53072457 nonsense probably null
R3426:Akap6 UTSW 12 52888034 missense probably damaging 1.00
R3934:Akap6 UTSW 12 53140444 missense possibly damaging 0.92
R3936:Akap6 UTSW 12 53140444 missense possibly damaging 0.92
R3967:Akap6 UTSW 12 53141453 missense probably damaging 1.00
R3970:Akap6 UTSW 12 53141453 missense probably damaging 1.00
R4042:Akap6 UTSW 12 53139379 critical splice acceptor site probably null
R4095:Akap6 UTSW 12 53139462 missense probably damaging 1.00
R4152:Akap6 UTSW 12 53140407 missense probably benign 0.45
R4231:Akap6 UTSW 12 53141038 missense probably damaging 1.00
R4232:Akap6 UTSW 12 53139671 missense probably damaging 1.00
R4233:Akap6 UTSW 12 53139671 missense probably damaging 1.00
R4234:Akap6 UTSW 12 53139671 missense probably damaging 1.00
R4235:Akap6 UTSW 12 53139671 missense probably damaging 1.00
R4236:Akap6 UTSW 12 53139671 missense probably damaging 1.00
R4475:Akap6 UTSW 12 53141643 missense probably benign 0.00
R4513:Akap6 UTSW 12 52796004 missense probably benign 0.03
R4686:Akap6 UTSW 12 52887623 frame shift probably null
R4724:Akap6 UTSW 12 52795885 missense possibly damaging 0.80
R4782:Akap6 UTSW 12 52887623 frame shift probably null
R4852:Akap6 UTSW 12 53104675 missense probably damaging 1.00
R5024:Akap6 UTSW 12 53142562 missense probably benign 0.01
R5116:Akap6 UTSW 12 53141515 missense probably benign 0.01
R5164:Akap6 UTSW 12 53142466 missense probably benign
R5225:Akap6 UTSW 12 52886546 missense probably damaging 1.00
R5269:Akap6 UTSW 12 53139843 missense probably damaging 0.99
R5352:Akap6 UTSW 12 52796097 missense probably damaging 1.00
R5496:Akap6 UTSW 12 53140653 missense possibly damaging 0.87
R5551:Akap6 UTSW 12 52795964 missense probably damaging 1.00
R5997:Akap6 UTSW 12 52937233 critical splice donor site probably null
R6137:Akap6 UTSW 12 53140354 missense probably damaging 1.00
R6151:Akap6 UTSW 12 53025792 missense probably damaging 1.00
R6169:Akap6 UTSW 12 53142358 missense probably benign
R6307:Akap6 UTSW 12 53141568 missense possibly damaging 0.85
R6351:Akap6 UTSW 12 53142025 missense probably damaging 0.98
R6479:Akap6 UTSW 12 53141169 missense probably damaging 1.00
R6502:Akap6 UTSW 12 53140215 missense probably damaging 1.00
R6760:Akap6 UTSW 12 53139778 missense probably damaging 1.00
R6778:Akap6 UTSW 12 53025816 missense probably damaging 1.00
R6837:Akap6 UTSW 12 53141262 missense probably damaging 1.00
R6896:Akap6 UTSW 12 52887494 missense probably benign 0.06
R6917:Akap6 UTSW 12 53069168 missense probably null 0.97
R6983:Akap6 UTSW 12 52887653 missense probably damaging 1.00
R7142:Akap6 UTSW 12 52887364 missense probably benign 0.02
R7143:Akap6 UTSW 12 52887364 missense probably benign 0.02
R7216:Akap6 UTSW 12 53140457 missense probably benign 0.02
R7297:Akap6 UTSW 12 52887364 missense probably benign 0.02
R7356:Akap6 UTSW 12 52911864 missense probably damaging 1.00
R7378:Akap6 UTSW 12 53142574 missense probably benign 0.00
R7382:Akap6 UTSW 12 53142171 missense probably benign 0.00
R7498:Akap6 UTSW 12 53142705 nonsense probably null
R7542:Akap6 UTSW 12 53069234 missense probably damaging 1.00
R7589:Akap6 UTSW 12 53142063 nonsense probably null
R7676:Akap6 UTSW 12 52886850 missense possibly damaging 0.94
R7814:Akap6 UTSW 12 53140961 missense probably benign 0.28
R8039:Akap6 UTSW 12 53141676 missense probably benign 0.00
X0062:Akap6 UTSW 12 53142361 missense probably benign 0.43
Z1176:Akap6 UTSW 12 53140444 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TAAAGCTAAGGTGCCCCGAC -3'
(R):5'- CCGAGATCCTAGATAAAGACCTGC -3'

Sequencing Primer
(F):5'- TAAGGTGCCCCGACATGTGTTC -3'
(R):5'- TAGATAAAGACCTGCTTACTTCCC -3'
Posted On2015-03-25