Mutagenetix > Incidental Mutation

Incidental Mutation 'R3783:Heatr1'

272134

Institutional Source

Beutler Lab

Gene Symbol

Heatr1

Ensembl Gene

ENSMUSG00000050244

Gene Name

HEAT repeat containing 1

Synonyms

B130016L12Rik

MMRRC Submission

040875-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.969) question?

Stock #

R3783 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

12395027-12440289 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 12434460 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Phenylalanine at position 1946 (L1946F)

Ref Sequence

ENSEMBL: ENSMUSP00000054084 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000059270] [ENSMUST00000099820] [ENSMUST00000099821] [ENSMUST00000124888] [ENSMUST00000135166] [ENSMUST00000143693]

AlphaFold

G3X9B1

Predicted Effect

probably damaging
Transcript: ENSMUST00000059270
AA Change: L1946F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000054084
Gene: ENSMUSG00000050244
AA Change: L1946F

Domain	Start	End	E-Value	Type
low complexity region	4	15	N/A	INTRINSIC
Pfam:U3snoRNP10	238	354	7e-30	PFAM
SCOP:d1qbkb_	919	1795	3e-8	SMART
low complexity region	1805	1814	N/A	INTRINSIC
BP28CT	1856	2009	2.25e-77	SMART
Blast:BP28CT	2015	2061	2e-15	BLAST
coiled coil region	2109	2137	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000099820

SMART Domains

Protein: ENSMUSP00000097408
Gene: ENSMUSG00000057554

Domain	Start	End	E-Value	Type
GLECT	16	151	3.05e-50	SMART
Gal-bind_lectin	22	150	7.41e-55	SMART
GLECT	184	316	1.38e-48	SMART
Gal-bind_lectin	190	315	1.28e-49	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000099821

SMART Domains

Protein: ENSMUSP00000097409
Gene: ENSMUSG00000057554

Domain	Start	End	E-Value	Type
GLECT	16	151	3.05e-50	SMART
Gal-bind_lectin	22	150	7.41e-55	SMART
GLECT	184	316	1.38e-48	SMART
Gal-bind_lectin	190	315	1.28e-49	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000124888

SMART Domains

Protein: ENSMUSP00000115094
Gene: ENSMUSG00000057554

Domain	Start	End	E-Value	Type
GLECT	16	151	3.05e-50	SMART
Gal-bind_lectin	22	150	7.41e-55	SMART
GLECT	184	316	1.38e-48	SMART
Gal-bind_lectin	190	315	1.28e-49	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133143

Predicted Effect

probably benign
Transcript: ENSMUST00000135166

SMART Domains

Protein: ENSMUSP00000120210
Gene: ENSMUSG00000057554

Domain	Start	End	E-Value	Type
Pfam:Gal-bind_lectin	1	57	4e-16	PFAM
GLECT	91	223	1.38e-48	SMART
Gal-bind_lectin	97	222	1.28e-49	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000143693

SMART Domains

Protein: ENSMUSP00000118925
Gene: ENSMUSG00000057554

Domain	Start	End	E-Value	Type
Pfam:Gal-bind_lectin	1	57	4e-16	PFAM
GLECT	91	223	1.38e-48	SMART
Gal-bind_lectin	97	222	1.28e-49	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221051

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221616

Predicted Effect

unknown
Transcript: ENSMUST00000222091
AA Change: L546F

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

98% (45/46)

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700012B07Rik	G	T	11: 109,794,154	C172*	probably null	Het
Akap6	A	G	12: 52,880,769	H154R	probably damaging	Het
Aoc1	T	C	6: 48,905,655	L177P	probably damaging	Het
Ascc3	A	G	10: 50,728,254	T1357A	probably damaging	Het
Atp13a3	A	T	16: 30,354,249	V270D	probably damaging	Het
BC055324	A	T	1: 163,987,683	C90S	probably benign	Het
Carmil3	T	C	14: 55,496,976	F418S	probably damaging	Het
Ccdc93	A	G	1: 121,437,869	N77S	probably damaging	Het
Cpt1b	T	C	15: 89,425,189	K47R	probably damaging	Het
Cyp4f14	A	G	17: 32,916,762	Y42H	probably benign	Het
Dmxl1	G	A	18: 49,865,122	S763N	probably damaging	Het
Fam129a	C	T	1: 151,689,648	S243L	possibly damaging	Het
Fancd2	T	G	6: 113,565,204	S770A	probably damaging	Het
Flnb	T	G	14: 7,889,236	W529G	probably benign	Het
Fryl	T	C	5: 73,101,476	Y655C	probably benign	Het
Gml	C	T	15: 74,813,672	V155M	probably damaging	Het
Gpr174	A	G	X: 107,293,064	T161A	probably benign	Het
Inpp5k	T	C	11: 75,647,686	L461P	probably damaging	Het
Isy1	T	C	6: 87,821,545	E209G	possibly damaging	Het
Kdm5b	A	G	1: 134,630,542	H1429R	probably benign	Het
Magi2	C	T	5: 20,465,909	T580M	probably damaging	Het
Map3k1	C	T	13: 111,756,220	V834I	probably benign	Het
Mdn1	A	T	4: 32,720,818	E2310D	probably benign	Het
Myo15	A	T	11: 60,477,572	Y386F	probably damaging	Het
Neurod1	T	A	2: 79,454,595	N148I	probably damaging	Het
Nsa2	G	T	13: 97,135,534	Q60K	possibly damaging	Het
Pcdha1	T	A	18: 36,930,802	L173Q	probably damaging	Het
Pdpk1	T	C	17: 24,110,850	T71A	possibly damaging	Het
Plxna2	T	A	1: 194,807,521	V1692E	probably damaging	Het
Pmepa1	G	A	2: 173,228,133	R210W	probably damaging	Het
Psg27	T	A	7: 18,560,354	Q376L	probably damaging	Het
Psmd4	T	C	3: 95,035,251	D6G	possibly damaging	Het
Ptch1	T	G	13: 63,524,959	E944A	probably benign	Het
Rala	T	A	13: 17,882,446	E185V	probably benign	Het
Sall4	A	G	2: 168,756,123	S266P	probably damaging	Het
Scn10a	T	C	9: 119,691,562	T91A	probably damaging	Het
Synrg	T	C	11: 84,001,920	F613S	probably damaging	Het
Tekt1	A	G	11: 72,344,894	I376T	probably damaging	Het
Tet2	T	C	3: 133,479,363	K1182R	possibly damaging	Het
Thbs4	T	C	13: 92,773,164	N375S	probably benign	Het
Thoc5	A	G	11: 4,920,372		probably benign	Het
Tmprss9	G	T	10: 80,887,467	V254F	probably damaging	Het
Tro	G	A	X: 150,655,052	T203I	possibly damaging	Het
Ttbk2	A	T	2: 120,773,815		probably benign	Het
Usf2	A	G	7: 30,955,831	V133A	probably benign	Het
Wap	G	A	11: 6,638,550	Q25*	probably null	Het
Xdh	C	T	17: 73,893,595		probably benign	Het
Xrn1	G	T	9: 95,969,285	M153I	probably benign	Het

Other mutations in Heatr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00666:Heatr1	APN	13	12410450	missense	probably benign	0.00
IGL00863:Heatr1	APN	13	12435128	missense	probably benign	0.02
IGL00899:Heatr1	APN	13	12435176	missense	probably benign	0.31
IGL01147:Heatr1	APN	13	12437912	missense	probably damaging	0.99
IGL01317:Heatr1	APN	13	12399027	missense	probably damaging	1.00
IGL01323:Heatr1	APN	13	12398938	missense	possibly damaging	0.86
IGL01625:Heatr1	APN	13	12413528	missense	probably damaging	0.98
IGL01973:Heatr1	APN	13	12429799	missense	probably benign
IGL02803:Heatr1	APN	13	12433986	missense	probably damaging	0.96
IGL02830:Heatr1	APN	13	12426212	missense	possibly damaging	0.57
IGL02956:Heatr1	APN	13	12416059	missense	possibly damaging	0.53
IGL03000:Heatr1	APN	13	12434411	missense	probably damaging	0.99
IGL03024:Heatr1	APN	13	12407509	unclassified	probably benign
IGL03035:Heatr1	APN	13	12413219	splice site	probably benign
IGL03301:Heatr1	APN	13	12434205	missense	probably damaging	1.00
hasan	UTSW	13	12417447	splice site	probably benign
H8562:Heatr1	UTSW	13	12408713	missense	probably benign	0.13
R0226:Heatr1	UTSW	13	12410562	missense	probably damaging	1.00
R0571:Heatr1	UTSW	13	12430240	missense	probably damaging	0.98
R0722:Heatr1	UTSW	13	12406037	missense	probably benign	0.14
R1264:Heatr1	UTSW	13	12424610	unclassified	probably benign
R1371:Heatr1	UTSW	13	12417632	missense	possibly damaging	0.80
R1388:Heatr1	UTSW	13	12417447	splice site	probably benign
R1396:Heatr1	UTSW	13	12406046	missense	possibly damaging	0.86
R1519:Heatr1	UTSW	13	12412159	missense	probably benign
R1689:Heatr1	UTSW	13	12424625	missense	probably benign	0.00
R1696:Heatr1	UTSW	13	12423721	missense	possibly damaging	0.96
R1756:Heatr1	UTSW	13	12396460	missense	probably benign	0.01
R1859:Heatr1	UTSW	13	12403159	missense	probably damaging	1.00
R1932:Heatr1	UTSW	13	12435185	missense	probably damaging	1.00
R1957:Heatr1	UTSW	13	12396538	missense	probably damaging	1.00
R2018:Heatr1	UTSW	13	12414478	missense	possibly damaging	0.68
R2106:Heatr1	UTSW	13	12412058	missense	probably benign	0.03
R2119:Heatr1	UTSW	13	12432646	missense	probably null	1.00
R2121:Heatr1	UTSW	13	12403264	missense	probably benign	0.10
R2122:Heatr1	UTSW	13	12403264	missense	probably benign	0.10
R2367:Heatr1	UTSW	13	12433724	missense	probably damaging	1.00
R3777:Heatr1	UTSW	13	12413348	missense	possibly damaging	0.92
R3784:Heatr1	UTSW	13	12434460	missense	probably damaging	1.00
R3786:Heatr1	UTSW	13	12434460	missense	probably damaging	1.00
R3787:Heatr1	UTSW	13	12434460	missense	probably damaging	1.00
R3843:Heatr1	UTSW	13	12435121	missense	probably benign	0.00
R4533:Heatr1	UTSW	13	12434511	missense	probably benign	0.05
R4725:Heatr1	UTSW	13	12424662	nonsense	probably null
R4763:Heatr1	UTSW	13	12430930	missense	possibly damaging	0.65
R4793:Heatr1	UTSW	13	12431837	missense	probably benign	0.00
R4797:Heatr1	UTSW	13	12412048	missense	probably benign	0.36
R4798:Heatr1	UTSW	13	12412048	missense	probably benign	0.36
R4942:Heatr1	UTSW	13	12413510	critical splice acceptor site	probably null
R4952:Heatr1	UTSW	13	12410599	missense	probably benign	0.38
R4954:Heatr1	UTSW	13	12407516	critical splice acceptor site	probably null
R5370:Heatr1	UTSW	13	12401522	missense	probably benign	0.02
R5464:Heatr1	UTSW	13	12433643	missense	probably benign	0.00
R5483:Heatr1	UTSW	13	12398914	missense	probably damaging	1.00
R5497:Heatr1	UTSW	13	12421064	missense	possibly damaging	0.93
R5504:Heatr1	UTSW	13	12406619	missense	possibly damaging	0.64
R5527:Heatr1	UTSW	13	12402760	missense	probably damaging	1.00
R5527:Heatr1	UTSW	13	12404948	missense	probably benign
R5836:Heatr1	UTSW	13	12408736	missense	probably damaging	0.99
R5916:Heatr1	UTSW	13	12434471	missense	probably damaging	1.00
R6018:Heatr1	UTSW	13	12404947	missense	probably benign
R6018:Heatr1	UTSW	13	12406058	missense	probably benign	0.26
R6216:Heatr1	UTSW	13	12432664	missense	probably benign	0.16
R6396:Heatr1	UTSW	13	12406097	missense	possibly damaging	0.86
R6472:Heatr1	UTSW	13	12434230	missense	probably benign	0.29
R6922:Heatr1	UTSW	13	12435075	missense	probably benign	0.00
R7077:Heatr1	UTSW	13	12418164	missense	possibly damaging	0.63
R7297:Heatr1	UTSW	13	12421060	nonsense	probably null
R7445:Heatr1	UTSW	13	12431038	missense	possibly damaging	0.70
R7669:Heatr1	UTSW	13	12411262	missense	probably benign	0.33
R7672:Heatr1	UTSW	13	12438664	missense	probably damaging	0.96
R7772:Heatr1	UTSW	13	12417641	missense	probably benign	0.03
R8205:Heatr1	UTSW	13	12416047	missense	probably benign
R8518:Heatr1	UTSW	13	12410534	missense	probably benign
R8754:Heatr1	UTSW	13	12413294	missense	probably damaging	0.99
R8874:Heatr1	UTSW	13	12430912	missense	probably damaging	1.00
R8992:Heatr1	UTSW	13	12401114	missense	probably damaging	0.98
R9045:Heatr1	UTSW	13	12413352	missense	probably benign	0.00
R9077:Heatr1	UTSW	13	12413366	missense	probably benign
R9183:Heatr1	UTSW	13	12421385	missense	probably damaging	0.99
R9186:Heatr1	UTSW	13	12421346	missense	probably damaging	1.00
R9223:Heatr1	UTSW	13	12404921	missense	probably benign	0.00
R9242:Heatr1	UTSW	13	12433925	missense	probably benign
R9267:Heatr1	UTSW	13	12406608	missense	probably damaging	1.00
R9289:Heatr1	UTSW	13	12432727	missense	probably benign	0.13
R9310:Heatr1	UTSW	13	12438610	missense	probably benign
R9312:Heatr1	UTSW	13	12431684	missense	probably benign
R9358:Heatr1	UTSW	13	12418206	missense	probably benign	0.09
R9385:Heatr1	UTSW	13	12406542	missense	probably damaging	1.00
R9530:Heatr1	UTSW	13	12424726	missense	probably damaging	1.00
R9532:Heatr1	UTSW	13	12414425	missense	possibly damaging	0.72
R9647:Heatr1	UTSW	13	12426798	missense	probably benign	0.00
R9683:Heatr1	UTSW	13	12434259	missense	probably damaging	1.00
R9695:Heatr1	UTSW	13	12423743	missense	probably damaging	1.00
RF011:Heatr1	UTSW	13	12407544	missense	probably benign	0.00
Z1176:Heatr1	UTSW	13	12399008	missense	possibly damaging	0.68

Predicted Primers

PCR Primer
(F):5'- AGGTCACATTCAGGCCTCTC -3'
(R):5'- ATGGCAAAGTAAAAGTTCACCATCC -3'

Sequencing Primer
(F):5'- AGGCCTCTCTTCTTCAAGGTGAG -3'
(R):5'- ACACCAAGGATTGTAAGTCTTTTCTG -3'

Posted On

2015-03-25