Incidental Mutation 'R3783:Heatr1'
ID 272134
Institutional Source Beutler Lab
Gene Symbol Heatr1
Ensembl Gene ENSMUSG00000050244
Gene Name HEAT repeat containing 1
Synonyms B130016L12Rik
MMRRC Submission 040875-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.965) question?
Stock # R3783 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 12410256-12453774 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 12449341 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Phenylalanine at position 1946 (L1946F)
Ref Sequence ENSEMBL: ENSMUSP00000054084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059270] [ENSMUST00000099820] [ENSMUST00000099821] [ENSMUST00000124888] [ENSMUST00000135166] [ENSMUST00000143693]
AlphaFold G3X9B1
Predicted Effect probably damaging
Transcript: ENSMUST00000059270
AA Change: L1946F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000054084
Gene: ENSMUSG00000050244
AA Change: L1946F

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
Pfam:U3snoRNP10 238 354 7e-30 PFAM
SCOP:d1qbkb_ 919 1795 3e-8 SMART
low complexity region 1805 1814 N/A INTRINSIC
BP28CT 1856 2009 2.25e-77 SMART
Blast:BP28CT 2015 2061 2e-15 BLAST
coiled coil region 2109 2137 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099820
SMART Domains Protein: ENSMUSP00000097408
Gene: ENSMUSG00000057554

DomainStartEndE-ValueType
GLECT 16 151 3.05e-50 SMART
Gal-bind_lectin 22 150 7.41e-55 SMART
GLECT 184 316 1.38e-48 SMART
Gal-bind_lectin 190 315 1.28e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000099821
SMART Domains Protein: ENSMUSP00000097409
Gene: ENSMUSG00000057554

DomainStartEndE-ValueType
GLECT 16 151 3.05e-50 SMART
Gal-bind_lectin 22 150 7.41e-55 SMART
GLECT 184 316 1.38e-48 SMART
Gal-bind_lectin 190 315 1.28e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124888
SMART Domains Protein: ENSMUSP00000115094
Gene: ENSMUSG00000057554

DomainStartEndE-ValueType
GLECT 16 151 3.05e-50 SMART
Gal-bind_lectin 22 150 7.41e-55 SMART
GLECT 184 316 1.38e-48 SMART
Gal-bind_lectin 190 315 1.28e-49 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133143
Predicted Effect probably benign
Transcript: ENSMUST00000135166
SMART Domains Protein: ENSMUSP00000120210
Gene: ENSMUSG00000057554

DomainStartEndE-ValueType
Pfam:Gal-bind_lectin 1 57 4e-16 PFAM
GLECT 91 223 1.38e-48 SMART
Gal-bind_lectin 97 222 1.28e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143693
SMART Domains Protein: ENSMUSP00000118925
Gene: ENSMUSG00000057554

DomainStartEndE-ValueType
Pfam:Gal-bind_lectin 1 57 4e-16 PFAM
GLECT 91 223 1.38e-48 SMART
Gal-bind_lectin 97 222 1.28e-49 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221051
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221616
Predicted Effect unknown
Transcript: ENSMUST00000222091
AA Change: L546F
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 98% (45/46)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,684,980 (GRCm39) C172* probably null Het
Akap6 A G 12: 52,927,552 (GRCm39) H154R probably damaging Het
Aoc1 T C 6: 48,882,589 (GRCm39) L177P probably damaging Het
Ascc3 A G 10: 50,604,350 (GRCm39) T1357A probably damaging Het
Atp13a3 A T 16: 30,173,067 (GRCm39) V270D probably damaging Het
Carmil3 T C 14: 55,734,433 (GRCm39) F418S probably damaging Het
Ccdc93 A G 1: 121,365,598 (GRCm39) N77S probably damaging Het
Cpt1b T C 15: 89,309,392 (GRCm39) K47R probably damaging Het
Cyp4f14 A G 17: 33,135,736 (GRCm39) Y42H probably benign Het
Dmxl1 G A 18: 49,998,189 (GRCm39) S763N probably damaging Het
Fancd2 T G 6: 113,542,165 (GRCm39) S770A probably damaging Het
Firrm A T 1: 163,815,252 (GRCm39) C90S probably benign Het
Flnb T G 14: 7,889,236 (GRCm38) W529G probably benign Het
Fryl T C 5: 73,258,819 (GRCm39) Y655C probably benign Het
Gml C T 15: 74,685,521 (GRCm39) V155M probably damaging Het
Gpr174 A G X: 106,336,670 (GRCm39) T161A probably benign Het
Inpp5k T C 11: 75,538,512 (GRCm39) L461P probably damaging Het
Isy1 T C 6: 87,798,527 (GRCm39) E209G possibly damaging Het
Kdm5b A G 1: 134,558,280 (GRCm39) H1429R probably benign Het
Magi2 C T 5: 20,670,907 (GRCm39) T580M probably damaging Het
Map3k1 C T 13: 111,892,754 (GRCm39) V834I probably benign Het
Mdn1 A T 4: 32,720,818 (GRCm39) E2310D probably benign Het
Myo15a A T 11: 60,368,398 (GRCm39) Y386F probably damaging Het
Neurod1 T A 2: 79,284,939 (GRCm39) N148I probably damaging Het
Niban1 C T 1: 151,565,399 (GRCm39) S243L possibly damaging Het
Nsa2 G T 13: 97,272,042 (GRCm39) Q60K possibly damaging Het
Pcdha1 T A 18: 37,063,855 (GRCm39) L173Q probably damaging Het
Pdpk1 T C 17: 24,329,824 (GRCm39) T71A possibly damaging Het
Plxna2 T A 1: 194,489,829 (GRCm39) V1692E probably damaging Het
Pmepa1 G A 2: 173,069,926 (GRCm39) R210W probably damaging Het
Psg27 T A 7: 18,294,279 (GRCm39) Q376L probably damaging Het
Psmd4 T C 3: 94,942,562 (GRCm39) D6G possibly damaging Het
Ptch1 T G 13: 63,672,773 (GRCm39) E944A probably benign Het
Rala T A 13: 18,057,031 (GRCm39) E185V probably benign Het
Sall4 A G 2: 168,598,043 (GRCm39) S266P probably damaging Het
Scn10a T C 9: 119,520,628 (GRCm39) T91A probably damaging Het
Synrg T C 11: 83,892,746 (GRCm39) F613S probably damaging Het
Tekt1 A G 11: 72,235,720 (GRCm39) I376T probably damaging Het
Tet2 T C 3: 133,185,124 (GRCm39) K1182R possibly damaging Het
Thbs4 T C 13: 92,909,672 (GRCm39) N375S probably benign Het
Thoc5 A G 11: 4,870,372 (GRCm39) probably benign Het
Tmprss9 G T 10: 80,723,301 (GRCm39) V254F probably damaging Het
Tro G A X: 149,438,048 (GRCm39) T203I possibly damaging Het
Ttbk2 A T 2: 120,604,296 (GRCm39) probably benign Het
Usf2 A G 7: 30,655,256 (GRCm39) V133A probably benign Het
Wap G A 11: 6,588,550 (GRCm39) Q25* probably null Het
Xdh C T 17: 74,200,590 (GRCm39) probably benign Het
Xrn1 G T 9: 95,851,338 (GRCm39) M153I probably benign Het
Other mutations in Heatr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00666:Heatr1 APN 13 12,425,331 (GRCm39) missense probably benign 0.00
IGL00863:Heatr1 APN 13 12,450,009 (GRCm39) missense probably benign 0.02
IGL00899:Heatr1 APN 13 12,450,057 (GRCm39) missense probably benign 0.31
IGL01147:Heatr1 APN 13 12,452,793 (GRCm39) missense probably damaging 0.99
IGL01317:Heatr1 APN 13 12,413,908 (GRCm39) missense probably damaging 1.00
IGL01323:Heatr1 APN 13 12,413,819 (GRCm39) missense possibly damaging 0.86
IGL01625:Heatr1 APN 13 12,428,409 (GRCm39) missense probably damaging 0.98
IGL01973:Heatr1 APN 13 12,444,680 (GRCm39) missense probably benign
IGL02803:Heatr1 APN 13 12,448,867 (GRCm39) missense probably damaging 0.96
IGL02830:Heatr1 APN 13 12,441,093 (GRCm39) missense possibly damaging 0.57
IGL02956:Heatr1 APN 13 12,430,940 (GRCm39) missense possibly damaging 0.53
IGL03000:Heatr1 APN 13 12,449,292 (GRCm39) missense probably damaging 0.99
IGL03024:Heatr1 APN 13 12,422,390 (GRCm39) unclassified probably benign
IGL03035:Heatr1 APN 13 12,428,100 (GRCm39) splice site probably benign
IGL03301:Heatr1 APN 13 12,449,086 (GRCm39) missense probably damaging 1.00
hasan UTSW 13 12,432,328 (GRCm39) splice site probably benign
H8562:Heatr1 UTSW 13 12,423,594 (GRCm39) missense probably benign 0.13
R0226:Heatr1 UTSW 13 12,425,443 (GRCm39) missense probably damaging 1.00
R0571:Heatr1 UTSW 13 12,445,121 (GRCm39) missense probably damaging 0.98
R0722:Heatr1 UTSW 13 12,420,918 (GRCm39) missense probably benign 0.14
R1264:Heatr1 UTSW 13 12,439,491 (GRCm39) unclassified probably benign
R1371:Heatr1 UTSW 13 12,432,513 (GRCm39) missense possibly damaging 0.80
R1388:Heatr1 UTSW 13 12,432,328 (GRCm39) splice site probably benign
R1396:Heatr1 UTSW 13 12,420,927 (GRCm39) missense possibly damaging 0.86
R1519:Heatr1 UTSW 13 12,427,040 (GRCm39) missense probably benign
R1689:Heatr1 UTSW 13 12,439,506 (GRCm39) missense probably benign 0.00
R1696:Heatr1 UTSW 13 12,438,602 (GRCm39) missense possibly damaging 0.96
R1756:Heatr1 UTSW 13 12,411,341 (GRCm39) missense probably benign 0.01
R1859:Heatr1 UTSW 13 12,418,040 (GRCm39) missense probably damaging 1.00
R1932:Heatr1 UTSW 13 12,450,066 (GRCm39) missense probably damaging 1.00
R1957:Heatr1 UTSW 13 12,411,419 (GRCm39) missense probably damaging 1.00
R2018:Heatr1 UTSW 13 12,429,359 (GRCm39) missense possibly damaging 0.68
R2106:Heatr1 UTSW 13 12,426,939 (GRCm39) missense probably benign 0.03
R2119:Heatr1 UTSW 13 12,447,527 (GRCm39) missense probably null 1.00
R2121:Heatr1 UTSW 13 12,418,145 (GRCm39) missense probably benign 0.10
R2122:Heatr1 UTSW 13 12,418,145 (GRCm39) missense probably benign 0.10
R2367:Heatr1 UTSW 13 12,448,605 (GRCm39) missense probably damaging 1.00
R3777:Heatr1 UTSW 13 12,428,229 (GRCm39) missense possibly damaging 0.92
R3784:Heatr1 UTSW 13 12,449,341 (GRCm39) missense probably damaging 1.00
R3786:Heatr1 UTSW 13 12,449,341 (GRCm39) missense probably damaging 1.00
R3787:Heatr1 UTSW 13 12,449,341 (GRCm39) missense probably damaging 1.00
R3843:Heatr1 UTSW 13 12,450,002 (GRCm39) missense probably benign 0.00
R4533:Heatr1 UTSW 13 12,449,392 (GRCm39) missense probably benign 0.05
R4725:Heatr1 UTSW 13 12,439,543 (GRCm39) nonsense probably null
R4763:Heatr1 UTSW 13 12,445,811 (GRCm39) missense possibly damaging 0.65
R4793:Heatr1 UTSW 13 12,446,718 (GRCm39) missense probably benign 0.00
R4797:Heatr1 UTSW 13 12,426,929 (GRCm39) missense probably benign 0.36
R4798:Heatr1 UTSW 13 12,426,929 (GRCm39) missense probably benign 0.36
R4942:Heatr1 UTSW 13 12,428,391 (GRCm39) critical splice acceptor site probably null
R4952:Heatr1 UTSW 13 12,425,480 (GRCm39) missense probably benign 0.38
R4954:Heatr1 UTSW 13 12,422,397 (GRCm39) critical splice acceptor site probably null
R5370:Heatr1 UTSW 13 12,416,403 (GRCm39) missense probably benign 0.02
R5464:Heatr1 UTSW 13 12,448,524 (GRCm39) missense probably benign 0.00
R5483:Heatr1 UTSW 13 12,413,795 (GRCm39) missense probably damaging 1.00
R5497:Heatr1 UTSW 13 12,435,945 (GRCm39) missense possibly damaging 0.93
R5504:Heatr1 UTSW 13 12,421,500 (GRCm39) missense possibly damaging 0.64
R5527:Heatr1 UTSW 13 12,419,829 (GRCm39) missense probably benign
R5527:Heatr1 UTSW 13 12,417,641 (GRCm39) missense probably damaging 1.00
R5836:Heatr1 UTSW 13 12,423,617 (GRCm39) missense probably damaging 0.99
R5916:Heatr1 UTSW 13 12,449,352 (GRCm39) missense probably damaging 1.00
R6018:Heatr1 UTSW 13 12,420,939 (GRCm39) missense probably benign 0.26
R6018:Heatr1 UTSW 13 12,419,828 (GRCm39) missense probably benign
R6216:Heatr1 UTSW 13 12,447,545 (GRCm39) missense probably benign 0.16
R6396:Heatr1 UTSW 13 12,420,978 (GRCm39) missense possibly damaging 0.86
R6472:Heatr1 UTSW 13 12,449,111 (GRCm39) missense probably benign 0.29
R6922:Heatr1 UTSW 13 12,449,956 (GRCm39) missense probably benign 0.00
R7077:Heatr1 UTSW 13 12,433,045 (GRCm39) missense possibly damaging 0.63
R7297:Heatr1 UTSW 13 12,435,941 (GRCm39) nonsense probably null
R7445:Heatr1 UTSW 13 12,445,919 (GRCm39) missense possibly damaging 0.70
R7669:Heatr1 UTSW 13 12,426,143 (GRCm39) missense probably benign 0.33
R7672:Heatr1 UTSW 13 12,453,545 (GRCm39) missense probably damaging 0.96
R7772:Heatr1 UTSW 13 12,432,522 (GRCm39) missense probably benign 0.03
R8205:Heatr1 UTSW 13 12,430,928 (GRCm39) missense probably benign
R8518:Heatr1 UTSW 13 12,425,415 (GRCm39) missense probably benign
R8754:Heatr1 UTSW 13 12,428,175 (GRCm39) missense probably damaging 0.99
R8874:Heatr1 UTSW 13 12,445,793 (GRCm39) missense probably damaging 1.00
R8992:Heatr1 UTSW 13 12,415,995 (GRCm39) missense probably damaging 0.98
R9045:Heatr1 UTSW 13 12,428,233 (GRCm39) missense probably benign 0.00
R9077:Heatr1 UTSW 13 12,428,247 (GRCm39) missense probably benign
R9183:Heatr1 UTSW 13 12,436,266 (GRCm39) missense probably damaging 0.99
R9186:Heatr1 UTSW 13 12,436,227 (GRCm39) missense probably damaging 1.00
R9223:Heatr1 UTSW 13 12,419,802 (GRCm39) missense probably benign 0.00
R9242:Heatr1 UTSW 13 12,448,806 (GRCm39) missense probably benign
R9267:Heatr1 UTSW 13 12,421,489 (GRCm39) missense probably damaging 1.00
R9289:Heatr1 UTSW 13 12,447,608 (GRCm39) missense probably benign 0.13
R9310:Heatr1 UTSW 13 12,453,491 (GRCm39) missense probably benign
R9312:Heatr1 UTSW 13 12,446,565 (GRCm39) missense probably benign
R9358:Heatr1 UTSW 13 12,433,087 (GRCm39) missense probably benign 0.09
R9385:Heatr1 UTSW 13 12,421,423 (GRCm39) missense probably damaging 1.00
R9530:Heatr1 UTSW 13 12,439,607 (GRCm39) missense probably damaging 1.00
R9532:Heatr1 UTSW 13 12,429,306 (GRCm39) missense possibly damaging 0.72
R9647:Heatr1 UTSW 13 12,441,679 (GRCm39) missense probably benign 0.00
R9683:Heatr1 UTSW 13 12,449,140 (GRCm39) missense probably damaging 1.00
R9695:Heatr1 UTSW 13 12,438,624 (GRCm39) missense probably damaging 1.00
RF011:Heatr1 UTSW 13 12,422,425 (GRCm39) missense probably benign 0.00
Z1176:Heatr1 UTSW 13 12,413,889 (GRCm39) missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- AGGTCACATTCAGGCCTCTC -3'
(R):5'- ATGGCAAAGTAAAAGTTCACCATCC -3'

Sequencing Primer
(F):5'- AGGCCTCTCTTCTTCAAGGTGAG -3'
(R):5'- ACACCAAGGATTGTAAGTCTTTTCTG -3'
Posted On 2015-03-25