Incidental Mutation 'R3783:Thbs4'
ID272137
Institutional Source Beutler Lab
Gene Symbol Thbs4
Ensembl Gene ENSMUSG00000021702
Gene Namethrombospondin 4
SynonymsTSP-4, TSP4
MMRRC Submission 040875-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3783 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location92751590-92794818 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 92773164 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 375 (N375S)
Ref Sequence ENSEMBL: ENSMUSP00000022213 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022213]
Predicted Effect probably benign
Transcript: ENSMUST00000022213
AA Change: N375S

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000022213
Gene: ENSMUSG00000021702
AA Change: N375S

DomainStartEndE-ValueType
low complexity region 6 18 N/A INTRINSIC
TSPN 26 194 1.66e-51 SMART
Pfam:COMP 220 264 1.2e-24 PFAM
low complexity region 280 290 N/A INTRINSIC
EGF 291 327 1.04e-3 SMART
EGF_CA 328 380 7.29e-8 SMART
EGF_CA 381 421 1.42e-10 SMART
EGF 425 464 4.32e-1 SMART
Pfam:TSP_3 498 533 7.1e-15 PFAM
Pfam:TSP_3 557 592 7.8e-17 PFAM
Pfam:TSP_3 616 653 1.4e-11 PFAM
Pfam:TSP_3 654 693 1.3e-10 PFAM
Pfam:TSP_3 694 729 1e-14 PFAM
Pfam:TSP_C 747 944 3.8e-102 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168299
Meta Mutation Damage Score 0.0654 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the thrombospondin protein family. Thrombospondin family members are adhesive glycoproteins that mediate cell-to-cell and cell-to-matrix interactions. This protein forms a pentamer and can bind to heparin and calcium. It is involved in local signaling in the developing and adult nervous system, and it contributes to spinal sensitization and neuropathic pain states. This gene is activated during the stromal response to invasive breast cancer. It may also play a role in inflammatory responses in Alzheimer's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a targeted allele exhibit increased sensitivity to cardiac pressure overload, including increased hypertrophy, decreased ejection fraction, decreased microvessle number, increased extracellular matrix deposition and increased fibrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Akap6 A G 12: 52,880,769 H154R probably damaging Het
Aoc1 T C 6: 48,905,655 L177P probably damaging Het
Ascc3 A G 10: 50,728,254 T1357A probably damaging Het
Atp13a3 A T 16: 30,354,249 V270D probably damaging Het
BC055324 A T 1: 163,987,683 C90S probably benign Het
Carmil3 T C 14: 55,496,976 F418S probably damaging Het
Ccdc93 A G 1: 121,437,869 N77S probably damaging Het
Cpt1b T C 15: 89,425,189 K47R probably damaging Het
Cyp4f14 A G 17: 32,916,762 Y42H probably benign Het
Dmxl1 G A 18: 49,865,122 S763N probably damaging Het
Fam129a C T 1: 151,689,648 S243L possibly damaging Het
Fancd2 T G 6: 113,565,204 S770A probably damaging Het
Flnb T G 14: 7,889,236 W529G probably benign Het
Fryl T C 5: 73,101,476 Y655C probably benign Het
Gml C T 15: 74,813,672 V155M probably damaging Het
Gpr174 A G X: 107,293,064 T161A probably benign Het
Heatr1 G T 13: 12,434,460 L1946F probably damaging Het
Inpp5k T C 11: 75,647,686 L461P probably damaging Het
Isy1 T C 6: 87,821,545 E209G possibly damaging Het
Kdm5b A G 1: 134,630,542 H1429R probably benign Het
Magi2 C T 5: 20,465,909 T580M probably damaging Het
Map3k1 C T 13: 111,756,220 V834I probably benign Het
Mdn1 A T 4: 32,720,818 E2310D probably benign Het
Myo15 A T 11: 60,477,572 Y386F probably damaging Het
Neurod1 T A 2: 79,454,595 N148I probably damaging Het
Nsa2 G T 13: 97,135,534 Q60K possibly damaging Het
Pcdha1 T A 18: 36,930,802 L173Q probably damaging Het
Pdpk1 T C 17: 24,110,850 T71A possibly damaging Het
Plxna2 T A 1: 194,807,521 V1692E probably damaging Het
Pmepa1 G A 2: 173,228,133 R210W probably damaging Het
Psg27 T A 7: 18,560,354 Q376L probably damaging Het
Psmd4 T C 3: 95,035,251 D6G possibly damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rala T A 13: 17,882,446 E185V probably benign Het
Sall4 A G 2: 168,756,123 S266P probably damaging Het
Scn10a T C 9: 119,691,562 T91A probably damaging Het
Synrg T C 11: 84,001,920 F613S probably damaging Het
Tekt1 A G 11: 72,344,894 I376T probably damaging Het
Tet2 T C 3: 133,479,363 K1182R possibly damaging Het
Thoc5 A G 11: 4,920,372 probably benign Het
Tmprss9 G T 10: 80,887,467 V254F probably damaging Het
Tro G A X: 150,655,052 T203I possibly damaging Het
Ttbk2 A T 2: 120,773,815 probably benign Het
Usf2 A G 7: 30,955,831 V133A probably benign Het
Wap G A 11: 6,638,550 Q25* probably null Het
Xdh C T 17: 73,893,595 probably benign Het
Xrn1 G T 9: 95,969,285 M153I probably benign Het
Other mutations in Thbs4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01680:Thbs4 APN 13 92776980 missense probably benign 0.04
IGL02318:Thbs4 APN 13 92763584 missense probably damaging 1.00
IGL02887:Thbs4 APN 13 92790798 missense probably benign 0.00
IGL03205:Thbs4 APN 13 92762774 missense probably damaging 1.00
IGL03382:Thbs4 APN 13 92769548 missense probably benign 0.37
R0087:Thbs4 UTSW 13 92755235 missense probably damaging 0.99
R0128:Thbs4 UTSW 13 92754410 missense probably benign 0.00
R0130:Thbs4 UTSW 13 92754410 missense probably benign 0.00
R0276:Thbs4 UTSW 13 92775532 missense probably benign 0.00
R0423:Thbs4 UTSW 13 92756571 missense probably damaging 0.99
R0504:Thbs4 UTSW 13 92767184 missense probably benign 0.04
R0708:Thbs4 UTSW 13 92773186 missense probably damaging 1.00
R0836:Thbs4 UTSW 13 92758038 missense probably damaging 1.00
R1078:Thbs4 UTSW 13 92762926 splice site probably benign
R1139:Thbs4 UTSW 13 92774718 missense probably damaging 1.00
R1253:Thbs4 UTSW 13 92776905 missense probably benign 0.17
R1342:Thbs4 UTSW 13 92752417 missense probably damaging 1.00
R1416:Thbs4 UTSW 13 92761533 missense probably benign
R1834:Thbs4 UTSW 13 92761481 missense probably benign 0.00
R1950:Thbs4 UTSW 13 92769571 missense probably damaging 0.99
R2056:Thbs4 UTSW 13 92790879 missense probably benign 0.00
R2184:Thbs4 UTSW 13 92774794 missense probably benign
R2198:Thbs4 UTSW 13 92763271 missense possibly damaging 0.78
R2859:Thbs4 UTSW 13 92790708 missense probably benign 0.02
R3605:Thbs4 UTSW 13 92757959 nonsense probably null
R3784:Thbs4 UTSW 13 92773164 missense probably benign 0.09
R3786:Thbs4 UTSW 13 92773164 missense probably benign 0.09
R3787:Thbs4 UTSW 13 92773164 missense probably benign 0.09
R4061:Thbs4 UTSW 13 92776097 critical splice donor site probably null
R4790:Thbs4 UTSW 13 92762806 missense probably damaging 1.00
R4968:Thbs4 UTSW 13 92758068 missense possibly damaging 0.55
R4983:Thbs4 UTSW 13 92790699 missense probably benign 0.29
R5185:Thbs4 UTSW 13 92775167 missense probably damaging 0.97
R5352:Thbs4 UTSW 13 92763590 missense probably damaging 1.00
R5361:Thbs4 UTSW 13 92776993 missense probably benign
R5589:Thbs4 UTSW 13 92776074 intron probably null
R5700:Thbs4 UTSW 13 92776953 missense probably benign 0.00
R6061:Thbs4 UTSW 13 92751795 missense probably benign 0.00
R6101:Thbs4 UTSW 13 92775485 missense possibly damaging 0.90
R6105:Thbs4 UTSW 13 92775485 missense possibly damaging 0.90
R6227:Thbs4 UTSW 13 92774682 missense probably null 1.00
R6249:Thbs4 UTSW 13 92774707 missense probably damaging 1.00
R6651:Thbs4 UTSW 13 92756536 missense probably benign 0.06
R6735:Thbs4 UTSW 13 92755166 missense possibly damaging 0.71
R6885:Thbs4 UTSW 13 92762869 missense probably damaging 0.96
R6913:Thbs4 UTSW 13 92757936 missense possibly damaging 0.94
R7409:Thbs4 UTSW 13 92773259 nonsense probably null
R7480:Thbs4 UTSW 13 92767221 missense probably benign 0.00
R7682:Thbs4 UTSW 13 92775562 missense probably benign 0.21
R8022:Thbs4 UTSW 13 92752447 missense not run
Z1177:Thbs4 UTSW 13 92754376 missense not run
Predicted Primers PCR Primer
(F):5'- TACTGCCTTCCCAGAGATACCC -3'
(R):5'- GAACGTTCCAAGTTATTTCCCC -3'

Sequencing Primer
(F):5'- GGCATATGTCTTCAGAAAGGAGCC -3'
(R):5'- GTTCCAAGTTATTTCCCCCAAAGAG -3'
Posted On2015-03-25