Incidental Mutation 'R3783:Carmil3'
ID272141
Institutional Source Beutler Lab
Gene Symbol Carmil3
Ensembl Gene ENSMUSG00000022211
Gene Namecapping protein regulator and myosin 1 linker 3
SynonymsLrrc16b
MMRRC Submission 040875-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.347) question?
Stock #R3783 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location55490651-55508272 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 55496976 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 418 (F418S)
Ref Sequence ENSEMBL: ENSMUSP00000075587 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076236] [ENSMUST00000226757] [ENSMUST00000228877]
Predicted Effect probably damaging
Transcript: ENSMUST00000076236
AA Change: F418S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000075587
Gene: ENSMUSG00000022211
AA Change: F418S

DomainStartEndE-ValueType
low complexity region 138 151 N/A INTRINSIC
internal_repeat_1 203 297 7.56e-6 PROSPERO
Blast:LRR 333 362 5e-10 BLAST
Blast:LRR 423 446 1e-5 BLAST
low complexity region 447 462 N/A INTRINSIC
low complexity region 468 479 N/A INTRINSIC
internal_repeat_1 496 593 7.56e-6 PROSPERO
Pfam:CARMIL_C 778 1065 5.3e-76 PFAM
low complexity region 1068 1117 N/A INTRINSIC
low complexity region 1137 1146 N/A INTRINSIC
low complexity region 1204 1216 N/A INTRINSIC
low complexity region 1318 1329 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226388
Predicted Effect probably benign
Transcript: ENSMUST00000226446
Predicted Effect probably benign
Transcript: ENSMUST00000226757
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227070
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227312
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227563
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228497
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228760
Predicted Effect probably benign
Transcript: ENSMUST00000228877
Meta Mutation Damage Score 0.8635 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 98% (45/46)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Akap6 A G 12: 52,880,769 H154R probably damaging Het
Aoc1 T C 6: 48,905,655 L177P probably damaging Het
Ascc3 A G 10: 50,728,254 T1357A probably damaging Het
Atp13a3 A T 16: 30,354,249 V270D probably damaging Het
BC055324 A T 1: 163,987,683 C90S probably benign Het
Ccdc93 A G 1: 121,437,869 N77S probably damaging Het
Cpt1b T C 15: 89,425,189 K47R probably damaging Het
Cyp4f14 A G 17: 32,916,762 Y42H probably benign Het
Dmxl1 G A 18: 49,865,122 S763N probably damaging Het
Fam129a C T 1: 151,689,648 S243L possibly damaging Het
Fancd2 T G 6: 113,565,204 S770A probably damaging Het
Flnb T G 14: 7,889,236 W529G probably benign Het
Fryl T C 5: 73,101,476 Y655C probably benign Het
Gml C T 15: 74,813,672 V155M probably damaging Het
Gpr174 A G X: 107,293,064 T161A probably benign Het
Heatr1 G T 13: 12,434,460 L1946F probably damaging Het
Inpp5k T C 11: 75,647,686 L461P probably damaging Het
Isy1 T C 6: 87,821,545 E209G possibly damaging Het
Kdm5b A G 1: 134,630,542 H1429R probably benign Het
Magi2 C T 5: 20,465,909 T580M probably damaging Het
Map3k1 C T 13: 111,756,220 V834I probably benign Het
Mdn1 A T 4: 32,720,818 E2310D probably benign Het
Myo15 A T 11: 60,477,572 Y386F probably damaging Het
Neurod1 T A 2: 79,454,595 N148I probably damaging Het
Nsa2 G T 13: 97,135,534 Q60K possibly damaging Het
Pcdha1 T A 18: 36,930,802 L173Q probably damaging Het
Pdpk1 T C 17: 24,110,850 T71A possibly damaging Het
Plxna2 T A 1: 194,807,521 V1692E probably damaging Het
Pmepa1 G A 2: 173,228,133 R210W probably damaging Het
Psg27 T A 7: 18,560,354 Q376L probably damaging Het
Psmd4 T C 3: 95,035,251 D6G possibly damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rala T A 13: 17,882,446 E185V probably benign Het
Sall4 A G 2: 168,756,123 S266P probably damaging Het
Scn10a T C 9: 119,691,562 T91A probably damaging Het
Synrg T C 11: 84,001,920 F613S probably damaging Het
Tekt1 A G 11: 72,344,894 I376T probably damaging Het
Tet2 T C 3: 133,479,363 K1182R possibly damaging Het
Thbs4 T C 13: 92,773,164 N375S probably benign Het
Thoc5 A G 11: 4,920,372 probably benign Het
Tmprss9 G T 10: 80,887,467 V254F probably damaging Het
Tro G A X: 150,655,052 T203I possibly damaging Het
Ttbk2 A T 2: 120,773,815 probably benign Het
Usf2 A G 7: 30,955,831 V133A probably benign Het
Wap G A 11: 6,638,550 Q25* probably null Het
Xdh C T 17: 73,893,595 probably benign Het
Xrn1 G T 9: 95,969,285 M153I probably benign Het
Other mutations in Carmil3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Carmil3 APN 14 55498298 missense probably damaging 0.99
IGL00498:Carmil3 APN 14 55501895 critical splice donor site probably null
IGL01061:Carmil3 APN 14 55498630 missense possibly damaging 0.67
IGL01452:Carmil3 APN 14 55496058 missense probably damaging 0.99
IGL01606:Carmil3 APN 14 55493849 missense possibly damaging 0.83
IGL01633:Carmil3 APN 14 55494227 missense possibly damaging 0.84
IGL01977:Carmil3 APN 14 55493536 missense probably damaging 1.00
IGL02065:Carmil3 APN 14 55493822 splice site probably benign
IGL02160:Carmil3 APN 14 55493558 missense possibly damaging 0.70
IGL02491:Carmil3 APN 14 55504517 missense probably benign 0.00
IGL02567:Carmil3 APN 14 55498882 missense possibly damaging 0.93
IGL02629:Carmil3 APN 14 55499068 missense probably damaging 0.97
IGL02720:Carmil3 APN 14 55507410 missense probably damaging 0.97
IGL03100:Carmil3 APN 14 55494718 missense probably damaging 0.99
PIT4434001:Carmil3 UTSW 14 55494688 missense probably null 1.00
R0023:Carmil3 UTSW 14 55492876 missense probably damaging 1.00
R0023:Carmil3 UTSW 14 55492876 missense probably damaging 1.00
R0027:Carmil3 UTSW 14 55494403 missense probably damaging 0.96
R0101:Carmil3 UTSW 14 55497755 splice site probably benign
R0321:Carmil3 UTSW 14 55502241 missense possibly damaging 0.63
R0370:Carmil3 UTSW 14 55495442 missense possibly damaging 0.82
R0465:Carmil3 UTSW 14 55499861 missense probably damaging 0.99
R0647:Carmil3 UTSW 14 55502435 critical splice donor site probably null
R1503:Carmil3 UTSW 14 55498280 missense probably damaging 0.96
R1635:Carmil3 UTSW 14 55496282 missense possibly damaging 0.91
R1715:Carmil3 UTSW 14 55504532 missense probably benign 0.02
R1923:Carmil3 UTSW 14 55502404 missense probably damaging 0.99
R1944:Carmil3 UTSW 14 55498630 missense probably damaging 0.97
R2513:Carmil3 UTSW 14 55503838 missense probably damaging 0.98
R2892:Carmil3 UTSW 14 55498313 missense probably damaging 0.96
R3433:Carmil3 UTSW 14 55507694 missense probably benign 0.05
R3552:Carmil3 UTSW 14 55507402 missense possibly damaging 0.86
R3787:Carmil3 UTSW 14 55496976 missense probably damaging 1.00
R4181:Carmil3 UTSW 14 55503955 missense probably benign 0.10
R4285:Carmil3 UTSW 14 55499476 utr 3 prime probably benign
R4420:Carmil3 UTSW 14 55493588 missense probably damaging 0.98
R4424:Carmil3 UTSW 14 55501471 missense probably benign
R4506:Carmil3 UTSW 14 55499476 utr 3 prime probably benign
R4507:Carmil3 UTSW 14 55499476 utr 3 prime probably benign
R4534:Carmil3 UTSW 14 55499476 utr 3 prime probably benign
R4535:Carmil3 UTSW 14 55499476 utr 3 prime probably benign
R4549:Carmil3 UTSW 14 55505664 splice site probably null
R4574:Carmil3 UTSW 14 55499476 utr 3 prime probably benign
R4783:Carmil3 UTSW 14 55501321 critical splice donor site probably null
R4784:Carmil3 UTSW 14 55501321 critical splice donor site probably null
R5146:Carmil3 UTSW 14 55497179 missense probably benign 0.02
R5279:Carmil3 UTSW 14 55501571 missense probably damaging 0.98
R5425:Carmil3 UTSW 14 55493877 missense probably benign 0.41
R5530:Carmil3 UTSW 14 55493624 missense probably damaging 0.98
R5534:Carmil3 UTSW 14 55494890 missense probably damaging 0.97
R5598:Carmil3 UTSW 14 55503999 frame shift probably null
R5772:Carmil3 UTSW 14 55493239 missense probably damaging 1.00
R5896:Carmil3 UTSW 14 55503999 frame shift probably null
R5931:Carmil3 UTSW 14 55498940 missense probably damaging 0.99
R6048:Carmil3 UTSW 14 55503845 missense probably benign 0.00
R6103:Carmil3 UTSW 14 55505427 missense probably benign 0.02
R6258:Carmil3 UTSW 14 55500432 missense probably damaging 1.00
R6260:Carmil3 UTSW 14 55500432 missense probably damaging 1.00
R6338:Carmil3 UTSW 14 55499849 missense possibly damaging 0.83
R6339:Carmil3 UTSW 14 55499849 missense possibly damaging 0.83
R6646:Carmil3 UTSW 14 55507930 missense probably damaging 0.97
R6936:Carmil3 UTSW 14 55501561 missense probably benign 0.04
R7164:Carmil3 UTSW 14 55501282 missense probably damaging 0.98
R7214:Carmil3 UTSW 14 55498612 missense probably damaging 1.00
R7223:Carmil3 UTSW 14 55496238 missense possibly damaging 0.48
R7269:Carmil3 UTSW 14 55493895 missense probably benign 0.03
R7319:Carmil3 UTSW 14 55494360 missense probably benign 0.13
R7357:Carmil3 UTSW 14 55491133 start gained probably benign
R7386:Carmil3 UTSW 14 55497747 critical splice donor site probably null
R7463:Carmil3 UTSW 14 55502396 missense probably damaging 1.00
R7598:Carmil3 UTSW 14 55494821 missense possibly damaging 0.61
R7602:Carmil3 UTSW 14 55501508 missense probably null 0.00
R7617:Carmil3 UTSW 14 55497891 missense probably benign 0.06
R8127:Carmil3 UTSW 14 55498244 missense probably damaging 0.98
U24488:Carmil3 UTSW 14 55497179 missense probably benign 0.02
Z1088:Carmil3 UTSW 14 55501568 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAAGATCTTAAGAGCCGC -3'
(R):5'- CCTGAAGAAGTGCCCTGTAGTG -3'

Sequencing Primer
(F):5'- AGATCTTAAGAGCCGCTGCGTC -3'
(R):5'- TGGGAAGGTCAGTAGGCCC -3'
Posted On2015-03-25