Incidental Mutation 'R3783:Cpt1b'
ID272144
Institutional Source Beutler Lab
Gene Symbol Cpt1b
Ensembl Gene ENSMUSG00000078937
Gene Namecarnitine palmitoyltransferase 1b, muscle
SynonymsM-CPTI, M-CPT I, Cpt1
MMRRC Submission 040875-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3783 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location89416405-89425863 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89425189 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 47 (K47R)
Ref Sequence ENSEMBL: ENSMUSP00000129786 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023289] [ENSMUST00000052315] [ENSMUST00000109313] [ENSMUST00000168376] [ENSMUST00000168646] [ENSMUST00000170460] [ENSMUST00000171666]
Predicted Effect probably benign
Transcript: ENSMUST00000023289
SMART Domains Protein: ENSMUSP00000023289
Gene: ENSMUSG00000022617

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
Pfam:APH 70 317 1.9e-14 PFAM
Pfam:Choline_kinase 97 308 1.5e-76 PFAM
low complexity region 324 344 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000052315
Predicted Effect possibly damaging
Transcript: ENSMUST00000109313
AA Change: K47R

PolyPhen 2 Score 0.471 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000104936
Gene: ENSMUSG00000078937
AA Change: K47R

DomainStartEndE-ValueType
Pfam:CPT_N 1 47 2.5e-29 PFAM
Pfam:Carn_acyltransf 173 762 1.3e-183 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000112664
Predicted Effect noncoding transcript
Transcript: ENSMUST00000115278
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165419
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165623
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166267
Predicted Effect probably damaging
Transcript: ENSMUST00000168376
AA Change: K47R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129786
Gene: ENSMUSG00000078937
AA Change: K47R

DomainStartEndE-ValueType
PDB:2LE3|A 1 42 1e-21 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000168646
Predicted Effect probably benign
Transcript: ENSMUST00000168879
SMART Domains Protein: ENSMUSP00000128188
Gene: ENSMUSG00000078937

DomainStartEndE-ValueType
Pfam:Carn_acyltransf 3 148 3.5e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170334
Predicted Effect probably benign
Transcript: ENSMUST00000170460
SMART Domains Protein: ENSMUSP00000128026
Gene: ENSMUSG00000022617

DomainStartEndE-ValueType
Pfam:Choline_kinase 1 176 1e-65 PFAM
Pfam:APH 8 176 6.1e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171140
Predicted Effect probably benign
Transcript: ENSMUST00000171666
SMART Domains Protein: ENSMUSP00000127191
Gene: ENSMUSG00000022617

DomainStartEndE-ValueType
Pfam:Choline_kinase 1 142 2.5e-51 PFAM
Pfam:APH 1 149 6.9e-14 PFAM
Pfam:EcKinase 2 116 8.8e-8 PFAM
Meta Mutation Damage Score 0.3023 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, a member of the carnitine/choline acetyltransferase family, is the rate-controlling enzyme of the long-chain fatty acid beta-oxidation pathway in muscle mitochondria. This enzyme is required for the net transport of long-chain fatty acyl-CoAs from the cytoplasm into the mitochondria. Multiple transcript variants encoding different isoforms have been found for this gene, and read-through transcripts are expressed from the upstream locus that include exons from this gene. [provided by RefSeq, Jun 2009]
PHENOTYPE: Homozygous null mice die in utero prior to E9.5. Heterozygous mutant mice exhibit susceptibility to fatal hypothermia following cold exposure, with females more severely affected. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Akap6 A G 12: 52,880,769 H154R probably damaging Het
Aoc1 T C 6: 48,905,655 L177P probably damaging Het
Ascc3 A G 10: 50,728,254 T1357A probably damaging Het
Atp13a3 A T 16: 30,354,249 V270D probably damaging Het
BC055324 A T 1: 163,987,683 C90S probably benign Het
Carmil3 T C 14: 55,496,976 F418S probably damaging Het
Ccdc93 A G 1: 121,437,869 N77S probably damaging Het
Cyp4f14 A G 17: 32,916,762 Y42H probably benign Het
Dmxl1 G A 18: 49,865,122 S763N probably damaging Het
Fam129a C T 1: 151,689,648 S243L possibly damaging Het
Fancd2 T G 6: 113,565,204 S770A probably damaging Het
Flnb T G 14: 7,889,236 W529G probably benign Het
Fryl T C 5: 73,101,476 Y655C probably benign Het
Gml C T 15: 74,813,672 V155M probably damaging Het
Gpr174 A G X: 107,293,064 T161A probably benign Het
Heatr1 G T 13: 12,434,460 L1946F probably damaging Het
Inpp5k T C 11: 75,647,686 L461P probably damaging Het
Isy1 T C 6: 87,821,545 E209G possibly damaging Het
Kdm5b A G 1: 134,630,542 H1429R probably benign Het
Magi2 C T 5: 20,465,909 T580M probably damaging Het
Map3k1 C T 13: 111,756,220 V834I probably benign Het
Mdn1 A T 4: 32,720,818 E2310D probably benign Het
Myo15 A T 11: 60,477,572 Y386F probably damaging Het
Neurod1 T A 2: 79,454,595 N148I probably damaging Het
Nsa2 G T 13: 97,135,534 Q60K possibly damaging Het
Pcdha1 T A 18: 36,930,802 L173Q probably damaging Het
Pdpk1 T C 17: 24,110,850 T71A possibly damaging Het
Plxna2 T A 1: 194,807,521 V1692E probably damaging Het
Pmepa1 G A 2: 173,228,133 R210W probably damaging Het
Psg27 T A 7: 18,560,354 Q376L probably damaging Het
Psmd4 T C 3: 95,035,251 D6G possibly damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rala T A 13: 17,882,446 E185V probably benign Het
Sall4 A G 2: 168,756,123 S266P probably damaging Het
Scn10a T C 9: 119,691,562 T91A probably damaging Het
Synrg T C 11: 84,001,920 F613S probably damaging Het
Tekt1 A G 11: 72,344,894 I376T probably damaging Het
Tet2 T C 3: 133,479,363 K1182R possibly damaging Het
Thbs4 T C 13: 92,773,164 N375S probably benign Het
Thoc5 A G 11: 4,920,372 probably benign Het
Tmprss9 G T 10: 80,887,467 V254F probably damaging Het
Tro G A X: 150,655,052 T203I possibly damaging Het
Ttbk2 A T 2: 120,773,815 probably benign Het
Usf2 A G 7: 30,955,831 V133A probably benign Het
Wap G A 11: 6,638,550 Q25* probably null Het
Xdh C T 17: 73,893,595 probably benign Het
Xrn1 G T 9: 95,969,285 M153I probably benign Het
Other mutations in Cpt1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Cpt1b APN 15 89420863 missense probably benign 0.01
IGL00497:Cpt1b APN 15 89422293 missense probably benign 0.22
IGL01142:Cpt1b APN 15 89418993 missense probably benign
IGL02329:Cpt1b APN 15 89423739 missense probably benign
IGL02740:Cpt1b APN 15 89424332 missense probably damaging 1.00
IGL03196:Cpt1b APN 15 89424395 missense probably benign
oleagenous UTSW 15 89425214 missense probably damaging 1.00
IGL02796:Cpt1b UTSW 15 89424802 missense probably benign 0.04
PIT4519001:Cpt1b UTSW 15 89418863 missense probably damaging 1.00
R0276:Cpt1b UTSW 15 89419959 missense probably benign 0.12
R0302:Cpt1b UTSW 15 89417870 missense probably benign
R0454:Cpt1b UTSW 15 89424393 missense possibly damaging 0.47
R1199:Cpt1b UTSW 15 89419010 missense probably benign 0.01
R1633:Cpt1b UTSW 15 89418815 missense probably damaging 0.98
R1674:Cpt1b UTSW 15 89422332 missense possibly damaging 0.64
R2087:Cpt1b UTSW 15 89422208 missense probably benign 0.07
R2178:Cpt1b UTSW 15 89419043 missense probably damaging 1.00
R2414:Cpt1b UTSW 15 89420080 splice site probably benign
R2507:Cpt1b UTSW 15 89419098 missense probably benign 0.08
R2883:Cpt1b UTSW 15 89417869 missense probably benign 0.00
R3432:Cpt1b UTSW 15 89423741 missense possibly damaging 0.85
R4574:Cpt1b UTSW 15 89424044 splice site probably null
R4737:Cpt1b UTSW 15 89421406 missense probably benign 0.03
R5122:Cpt1b UTSW 15 89424023 missense probably benign 0.09
R5320:Cpt1b UTSW 15 89419274 missense probably benign 0.00
R5365:Cpt1b UTSW 15 89420107 missense possibly damaging 0.78
R5699:Cpt1b UTSW 15 89424273 missense probably benign 0.44
R5710:Cpt1b UTSW 15 89425206 missense probably damaging 1.00
R5873:Cpt1b UTSW 15 89420728 missense probably damaging 1.00
R5941:Cpt1b UTSW 15 89425214 missense probably damaging 1.00
R6163:Cpt1b UTSW 15 89424417 missense probably benign 0.15
R6197:Cpt1b UTSW 15 89424834 missense possibly damaging 0.77
R6323:Cpt1b UTSW 15 89419063 missense probably benign 0.10
R6486:Cpt1b UTSW 15 89420824 missense probably benign
R7571:Cpt1b UTSW 15 89421343 critical splice donor site probably null
R7648:Cpt1b UTSW 15 89421367 missense probably damaging 1.00
R7743:Cpt1b UTSW 15 89421404 missense probably benign 0.25
R7893:Cpt1b UTSW 15 89423654 critical splice donor site probably null
R8021:Cpt1b UTSW 15 89421426 missense probably benign 0.00
R8207:Cpt1b UTSW 15 89418815 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GATGCCATTCTGTAGGGAAGAAAC -3'
(R):5'- ACACTAAGCACCTTCTGGCC -3'

Sequencing Primer
(F):5'- AATATCACTAGGCCCCTGGGTAG -3'
(R):5'- GCCCTGTTAGGTGCTGAATAAACC -3'
Posted On2015-03-25