Incidental Mutation 'R3783:Cyp4f14'
ID272147
Institutional Source Beutler Lab
Gene Symbol Cyp4f14
Ensembl Gene ENSMUSG00000024292
Gene Namecytochrome P450, family 4, subfamily f, polypeptide 14
Synonymsleukotriene B4 omega hydroxylase, 1300014O15Rik
MMRRC Submission 040875-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3783 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location32905071-32917342 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32916762 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 42 (Y42H)
Ref Sequence ENSEMBL: ENSMUSP00000136139 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054174] [ENSMUST00000179434]
Predicted Effect probably benign
Transcript: ENSMUST00000054174
AA Change: Y42H

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000050478
Gene: ENSMUSG00000024292
AA Change: Y42H

DomainStartEndE-ValueType
Pfam:p450 52 515 2.7e-136 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179434
AA Change: Y42H

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000136139
Gene: ENSMUSG00000024292
AA Change: Y42H

DomainStartEndE-ValueType
Pfam:p450 52 515 2.7e-136 PFAM
Meta Mutation Damage Score 0.3370 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein likely localizes to the endoplasmic reticulum. When expressed in yeast the enzyme is capable of oxdizing arachidonic acid. It can also catalyze the epoxidation of 22:6n-3 and 22:5n-3 polyunsaturated long-chain fatty acids. This gene is part of a cluster of cytochrome P450 genes on chromosome 19. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced vitamin E-omega-hydroxylase activity and altered levels of tocopherols and their metabolites. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Akap6 A G 12: 52,880,769 H154R probably damaging Het
Aoc1 T C 6: 48,905,655 L177P probably damaging Het
Ascc3 A G 10: 50,728,254 T1357A probably damaging Het
Atp13a3 A T 16: 30,354,249 V270D probably damaging Het
BC055324 A T 1: 163,987,683 C90S probably benign Het
Carmil3 T C 14: 55,496,976 F418S probably damaging Het
Ccdc93 A G 1: 121,437,869 N77S probably damaging Het
Cpt1b T C 15: 89,425,189 K47R probably damaging Het
Dmxl1 G A 18: 49,865,122 S763N probably damaging Het
Fam129a C T 1: 151,689,648 S243L possibly damaging Het
Fancd2 T G 6: 113,565,204 S770A probably damaging Het
Flnb T G 14: 7,889,236 W529G probably benign Het
Fryl T C 5: 73,101,476 Y655C probably benign Het
Gml C T 15: 74,813,672 V155M probably damaging Het
Gpr174 A G X: 107,293,064 T161A probably benign Het
Heatr1 G T 13: 12,434,460 L1946F probably damaging Het
Inpp5k T C 11: 75,647,686 L461P probably damaging Het
Isy1 T C 6: 87,821,545 E209G possibly damaging Het
Kdm5b A G 1: 134,630,542 H1429R probably benign Het
Magi2 C T 5: 20,465,909 T580M probably damaging Het
Map3k1 C T 13: 111,756,220 V834I probably benign Het
Mdn1 A T 4: 32,720,818 E2310D probably benign Het
Myo15 A T 11: 60,477,572 Y386F probably damaging Het
Neurod1 T A 2: 79,454,595 N148I probably damaging Het
Nsa2 G T 13: 97,135,534 Q60K possibly damaging Het
Pcdha1 T A 18: 36,930,802 L173Q probably damaging Het
Pdpk1 T C 17: 24,110,850 T71A possibly damaging Het
Plxna2 T A 1: 194,807,521 V1692E probably damaging Het
Pmepa1 G A 2: 173,228,133 R210W probably damaging Het
Psg27 T A 7: 18,560,354 Q376L probably damaging Het
Psmd4 T C 3: 95,035,251 D6G possibly damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rala T A 13: 17,882,446 E185V probably benign Het
Sall4 A G 2: 168,756,123 S266P probably damaging Het
Scn10a T C 9: 119,691,562 T91A probably damaging Het
Synrg T C 11: 84,001,920 F613S probably damaging Het
Tekt1 A G 11: 72,344,894 I376T probably damaging Het
Tet2 T C 3: 133,479,363 K1182R possibly damaging Het
Thbs4 T C 13: 92,773,164 N375S probably benign Het
Thoc5 A G 11: 4,920,372 probably benign Het
Tmprss9 G T 10: 80,887,467 V254F probably damaging Het
Tro G A X: 150,655,052 T203I possibly damaging Het
Ttbk2 A T 2: 120,773,815 probably benign Het
Usf2 A G 7: 30,955,831 V133A probably benign Het
Wap G A 11: 6,638,550 Q25* probably null Het
Xdh C T 17: 73,893,595 probably benign Het
Xrn1 G T 9: 95,969,285 M153I probably benign Het
Other mutations in Cyp4f14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Cyp4f14 APN 17 32914566 missense probably benign 0.06
IGL00858:Cyp4f14 APN 17 32911718 splice site probably benign
IGL01673:Cyp4f14 APN 17 32911151 splice site probably null
IGL01716:Cyp4f14 APN 17 32905496 utr 3 prime probably benign
IGL01768:Cyp4f14 APN 17 32908002 missense probably damaging 1.00
IGL02314:Cyp4f14 APN 17 32906291 missense probably benign 0.12
IGL02697:Cyp4f14 APN 17 32905623 missense probably damaging 0.97
IGL03035:Cyp4f14 APN 17 32914634 missense probably benign 0.15
dust UTSW 17 32916879 nonsense probably null
powder UTSW 17 32905509 missense probably benign 0.00
PIT4434001:Cyp4f14 UTSW 17 32906130 missense possibly damaging 0.94
R1186:Cyp4f14 UTSW 17 32916786 missense probably benign
R1230:Cyp4f14 UTSW 17 32916788 missense probably benign 0.00
R1671:Cyp4f14 UTSW 17 32916909 intron probably benign
R1672:Cyp4f14 UTSW 17 32909236 missense probably benign 0.00
R1696:Cyp4f14 UTSW 17 32909171 missense possibly damaging 0.81
R1828:Cyp4f14 UTSW 17 32911235 missense probably damaging 0.98
R1934:Cyp4f14 UTSW 17 32906315 missense probably damaging 1.00
R2023:Cyp4f14 UTSW 17 32906531 missense probably damaging 1.00
R3013:Cyp4f14 UTSW 17 32909165 missense probably benign 0.01
R4013:Cyp4f14 UTSW 17 32916879 nonsense probably null
R4369:Cyp4f14 UTSW 17 32909258 missense probably benign
R4371:Cyp4f14 UTSW 17 32909258 missense probably benign
R4683:Cyp4f14 UTSW 17 32908011 missense probably null 0.78
R5282:Cyp4f14 UTSW 17 32907985 missense probably damaging 0.99
R5332:Cyp4f14 UTSW 17 32906091 missense probably benign 0.00
R5810:Cyp4f14 UTSW 17 32906098 missense possibly damaging 0.88
R6244:Cyp4f14 UTSW 17 32906317 missense probably benign 0.41
R6622:Cyp4f14 UTSW 17 32914645 missense probably benign
R6972:Cyp4f14 UTSW 17 32905509 missense probably benign 0.00
R6975:Cyp4f14 UTSW 17 32914634 missense probably benign 0.01
R7124:Cyp4f14 UTSW 17 32914588 missense probably benign 0.00
R7436:Cyp4f14 UTSW 17 32909157 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CAGCCTATGGTGAGAGTACAGG -3'
(R):5'- TGAGATTATTGTCCCTTTCCGG -3'

Sequencing Primer
(F):5'- GCTTGGAAAGACACACCAAAGGTC -3'
(R):5'- CCGGGACCTCAGTTACTCAC -3'
Posted On2015-03-25