Incidental Mutation 'R3783:Gpr174'
ID272150
Institutional Source Beutler Lab
Gene Symbol Gpr174
Ensembl Gene ENSMUSG00000073008
Gene NameG protein-coupled receptor 174
SynonymsLOC213439
MMRRC Submission 040875-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.015) question?
Stock #R3783 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location107255878-107296769 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 107293064 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 161 (T161A)
Ref Sequence ENSEMBL: ENSMUSP00000137372 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101294] [ENSMUST00000117310] [ENSMUST00000118820] [ENSMUST00000120971] [ENSMUST00000178838]
Predicted Effect probably benign
Transcript: ENSMUST00000101294
AA Change: T161A

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000098852
Gene: ENSMUSG00000073008
AA Change: T161A

DomainStartEndE-ValueType
Pfam:7tm_1 36 292 2.5e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117310
AA Change: T161A

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000112808
Gene: ENSMUSG00000073008
AA Change: T161A

DomainStartEndE-ValueType
Pfam:7tm_1 36 292 2.5e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118820
AA Change: T161A

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000113032
Gene: ENSMUSG00000073008
AA Change: T161A

DomainStartEndE-ValueType
Pfam:7tm_1 36 292 2.6e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120971
AA Change: T161A

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000112974
Gene: ENSMUSG00000073008
AA Change: T161A

DomainStartEndE-ValueType
Pfam:7tm_1 36 292 2.5e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138031
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156709
Predicted Effect probably benign
Transcript: ENSMUST00000178838
AA Change: T161A

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000137372
Gene: ENSMUSG00000073008
AA Change: T161A

DomainStartEndE-ValueType
Pfam:7tm_1 36 292 2.5e-45 PFAM
Meta Mutation Damage Score 0.0702 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the G protein-coupled receptor superfamily. These proteins are characterized by the presence of seven alpha-helical transmembrane domains, and they activate or interact with various endogenous or exogenous ligands, including neurotransmitters, hormones, and odorant and taste substances. This family member is classified as an orphan receptor because the cognate ligand has not been identified. [provided by RefSeq, Sep 2011]
PHENOTYPE: Male mice hemizygous for a knock-out allele exhibit abnormal T cell proliferation, abnormal regulatory T cell physiology and decreased susceptibility to EAE. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Akap6 A G 12: 52,880,769 H154R probably damaging Het
Aoc1 T C 6: 48,905,655 L177P probably damaging Het
Ascc3 A G 10: 50,728,254 T1357A probably damaging Het
Atp13a3 A T 16: 30,354,249 V270D probably damaging Het
BC055324 A T 1: 163,987,683 C90S probably benign Het
Carmil3 T C 14: 55,496,976 F418S probably damaging Het
Ccdc93 A G 1: 121,437,869 N77S probably damaging Het
Cpt1b T C 15: 89,425,189 K47R probably damaging Het
Cyp4f14 A G 17: 32,916,762 Y42H probably benign Het
Dmxl1 G A 18: 49,865,122 S763N probably damaging Het
Fam129a C T 1: 151,689,648 S243L possibly damaging Het
Fancd2 T G 6: 113,565,204 S770A probably damaging Het
Flnb T G 14: 7,889,236 W529G probably benign Het
Fryl T C 5: 73,101,476 Y655C probably benign Het
Gml C T 15: 74,813,672 V155M probably damaging Het
Heatr1 G T 13: 12,434,460 L1946F probably damaging Het
Inpp5k T C 11: 75,647,686 L461P probably damaging Het
Isy1 T C 6: 87,821,545 E209G possibly damaging Het
Kdm5b A G 1: 134,630,542 H1429R probably benign Het
Magi2 C T 5: 20,465,909 T580M probably damaging Het
Map3k1 C T 13: 111,756,220 V834I probably benign Het
Mdn1 A T 4: 32,720,818 E2310D probably benign Het
Myo15 A T 11: 60,477,572 Y386F probably damaging Het
Neurod1 T A 2: 79,454,595 N148I probably damaging Het
Nsa2 G T 13: 97,135,534 Q60K possibly damaging Het
Pcdha1 T A 18: 36,930,802 L173Q probably damaging Het
Pdpk1 T C 17: 24,110,850 T71A possibly damaging Het
Plxna2 T A 1: 194,807,521 V1692E probably damaging Het
Pmepa1 G A 2: 173,228,133 R210W probably damaging Het
Psg27 T A 7: 18,560,354 Q376L probably damaging Het
Psmd4 T C 3: 95,035,251 D6G possibly damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rala T A 13: 17,882,446 E185V probably benign Het
Sall4 A G 2: 168,756,123 S266P probably damaging Het
Scn10a T C 9: 119,691,562 T91A probably damaging Het
Synrg T C 11: 84,001,920 F613S probably damaging Het
Tekt1 A G 11: 72,344,894 I376T probably damaging Het
Tet2 T C 3: 133,479,363 K1182R possibly damaging Het
Thbs4 T C 13: 92,773,164 N375S probably benign Het
Thoc5 A G 11: 4,920,372 probably benign Het
Tmprss9 G T 10: 80,887,467 V254F probably damaging Het
Tro G A X: 150,655,052 T203I possibly damaging Het
Ttbk2 A T 2: 120,773,815 probably benign Het
Usf2 A G 7: 30,955,831 V133A probably benign Het
Wap G A 11: 6,638,550 Q25* probably null Het
Xdh C T 17: 73,893,595 probably benign Het
Xrn1 G T 9: 95,969,285 M153I probably benign Het
Other mutations in Gpr174
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02379:Gpr174 APN X 107293478 missense probably damaging 1.00
IGL02512:Gpr174 APN X 107292971 nonsense probably null
IGL02563:Gpr174 APN X 107293248 missense probably benign 0.25
Z1177:Gpr174 UTSW X 107293193 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TGTATGCCAGCATCTACTTCTTGG -3'
(R):5'- ACAGGTCAGAATCATCTTCAGGG -3'

Sequencing Primer
(F):5'- GTCTGCATCAGTGTGCGAAG -3'
(R):5'- TCTCTCCAAGATGTTGAGAAATGGG -3'
Posted On2015-03-25