Incidental Mutation 'R3783:Tro'
ID272151
Institutional Source Beutler Lab
Gene Symbol Tro
Ensembl Gene ENSMUSG00000025272
Gene Nametrophinin
SynonymsMaged3, Maged3l, magphinin, magphinin-alpha, magphinin-beta 2, magphinin-gamma, necdin and trophinin like, Tnn, Trol, trophinin-2
MMRRC Submission 040875-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R3783 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location150645304-150657583 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 150655052 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 203 (T203I)
Ref Sequence ENSEMBL: ENSMUSP00000116905 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087253] [ENSMUST00000087258] [ENSMUST00000112709] [ENSMUST00000148604] [ENSMUST00000151403] [ENSMUST00000163450] [ENSMUST00000163969] [ENSMUST00000164071]
Predicted Effect probably benign
Transcript: ENSMUST00000087253
AA Change: T203I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000084508
Gene: ENSMUSG00000025272
AA Change: T203I

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
low complexity region 48 55 N/A INTRINSIC
internal_repeat_2 62 105 5.33e-6 PROSPERO
internal_repeat_1 95 280 8.68e-15 PROSPERO
internal_repeat_2 120 164 5.33e-6 PROSPERO
internal_repeat_1 275 441 8.68e-15 PROSPERO
low complexity region 445 471 N/A INTRINSIC
low complexity region 491 501 N/A INTRINSIC
low complexity region 526 542 N/A INTRINSIC
Pfam:MAGE 596 765 8e-60 PFAM
SCOP:d1gt91_ 780 951 9e-3 SMART
Predicted Effect unknown
Transcript: ENSMUST00000087258
AA Change: T203I
SMART Domains Protein: ENSMUSP00000084513
Gene: ENSMUSG00000025272
AA Change: T203I

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
low complexity region 48 55 N/A INTRINSIC
internal_repeat_3 62 105 6.04e-6 PROSPERO
internal_repeat_2 95 280 2.73e-15 PROSPERO
internal_repeat_3 120 164 6.04e-6 PROSPERO
internal_repeat_2 275 441 2.73e-15 PROSPERO
low complexity region 445 471 N/A INTRINSIC
low complexity region 491 501 N/A INTRINSIC
low complexity region 526 542 N/A INTRINSIC
Pfam:MAGE 596 765 1.6e-58 PFAM
low complexity region 794 810 N/A INTRINSIC
low complexity region 891 1028 N/A INTRINSIC
low complexity region 1057 1073 N/A INTRINSIC
low complexity region 1087 1108 N/A INTRINSIC
low complexity region 1110 1142 N/A INTRINSIC
low complexity region 1144 1155 N/A INTRINSIC
low complexity region 1157 1175 N/A INTRINSIC
internal_repeat_1 1176 1361 9.97e-23 PROSPERO
low complexity region 1393 1409 N/A INTRINSIC
internal_repeat_1 1540 1728 9.97e-23 PROSPERO
low complexity region 1764 1786 N/A INTRINSIC
low complexity region 1790 1815 N/A INTRINSIC
low complexity region 1821 1836 N/A INTRINSIC
low complexity region 1870 1910 N/A INTRINSIC
low complexity region 1915 1931 N/A INTRINSIC
low complexity region 1962 2085 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000112709
AA Change: T203I
SMART Domains Protein: ENSMUSP00000108329
Gene: ENSMUSG00000025272
AA Change: T203I

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
low complexity region 48 55 N/A INTRINSIC
internal_repeat_3 62 105 6.04e-6 PROSPERO
internal_repeat_2 95 280 2.73e-15 PROSPERO
internal_repeat_3 120 164 6.04e-6 PROSPERO
internal_repeat_2 275 441 2.73e-15 PROSPERO
low complexity region 445 471 N/A INTRINSIC
low complexity region 491 501 N/A INTRINSIC
low complexity region 526 542 N/A INTRINSIC
MAGE 596 765 2.03e-90 SMART
low complexity region 794 810 N/A INTRINSIC
low complexity region 891 1028 N/A INTRINSIC
low complexity region 1057 1073 N/A INTRINSIC
low complexity region 1087 1108 N/A INTRINSIC
low complexity region 1110 1142 N/A INTRINSIC
low complexity region 1144 1155 N/A INTRINSIC
low complexity region 1157 1175 N/A INTRINSIC
internal_repeat_1 1176 1361 9.97e-23 PROSPERO
low complexity region 1393 1409 N/A INTRINSIC
internal_repeat_1 1540 1728 9.97e-23 PROSPERO
low complexity region 1764 1786 N/A INTRINSIC
low complexity region 1790 1815 N/A INTRINSIC
low complexity region 1821 1836 N/A INTRINSIC
low complexity region 1870 1910 N/A INTRINSIC
low complexity region 1915 1931 N/A INTRINSIC
low complexity region 1962 2085 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000148604
AA Change: T203I

PolyPhen 2 Score 0.826 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000116905
Gene: ENSMUSG00000025272
AA Change: T203I

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
low complexity region 48 55 N/A INTRINSIC
internal_repeat_1 95 280 5.1e-9 PROSPERO
internal_repeat_1 275 441 5.1e-9 PROSPERO
low complexity region 445 471 N/A INTRINSIC
low complexity region 491 501 N/A INTRINSIC
low complexity region 526 542 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000151403
AA Change: T203I
SMART Domains Protein: ENSMUSP00000120457
Gene: ENSMUSG00000025272
AA Change: T203I

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
low complexity region 48 55 N/A INTRINSIC
internal_repeat_1 95 280 6.85e-11 PROSPERO
internal_repeat_1 275 441 6.85e-11 PROSPERO
low complexity region 445 471 N/A INTRINSIC
low complexity region 491 501 N/A INTRINSIC
low complexity region 526 542 N/A INTRINSIC
Pfam:MAGE 596 765 6.3e-60 PFAM
low complexity region 794 808 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163450
Predicted Effect unknown
Transcript: ENSMUST00000163969
AA Change: T203I
SMART Domains Protein: ENSMUSP00000126054
Gene: ENSMUSG00000025272
AA Change: T203I

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
low complexity region 48 55 N/A INTRINSIC
internal_repeat_1 95 280 5.6e-10 PROSPERO
internal_repeat_1 275 441 5.6e-10 PROSPERO
low complexity region 445 471 N/A INTRINSIC
low complexity region 491 501 N/A INTRINSIC
low complexity region 526 542 N/A INTRINSIC
Pfam:MAGE 596 765 5.9e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164071
SMART Domains Protein: ENSMUSP00000126042
Gene: ENSMUSG00000025272

DomainStartEndE-ValueType
Pfam:MAGE 54 223 7.1e-61 PFAM
low complexity region 252 266 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165192
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169450
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171775
Meta Mutation Damage Score 0.1267 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane protein that mediates cell adhesion between trophoblastic cells and the epithelial cells of the endometrium. The encoded protein participates in cell signalling during embryo implantation, and may also be involved in cancer formation. This gene is located near several other closely related genes on chromosome X. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2012]
PHENOTYPE: Homozygous female or hemizygous male mice on a mixed 129 and NIH black Swiss background are viable, fertile and elderly mice exhibit no disorders. On an inbred 129 background, homozygous female or hemizygous male mice show partial embryonic lethality between E3.5 and E8.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Akap6 A G 12: 52,880,769 H154R probably damaging Het
Aoc1 T C 6: 48,905,655 L177P probably damaging Het
Ascc3 A G 10: 50,728,254 T1357A probably damaging Het
Atp13a3 A T 16: 30,354,249 V270D probably damaging Het
BC055324 A T 1: 163,987,683 C90S probably benign Het
Carmil3 T C 14: 55,496,976 F418S probably damaging Het
Ccdc93 A G 1: 121,437,869 N77S probably damaging Het
Cpt1b T C 15: 89,425,189 K47R probably damaging Het
Cyp4f14 A G 17: 32,916,762 Y42H probably benign Het
Dmxl1 G A 18: 49,865,122 S763N probably damaging Het
Fam129a C T 1: 151,689,648 S243L possibly damaging Het
Fancd2 T G 6: 113,565,204 S770A probably damaging Het
Flnb T G 14: 7,889,236 W529G probably benign Het
Fryl T C 5: 73,101,476 Y655C probably benign Het
Gml C T 15: 74,813,672 V155M probably damaging Het
Gpr174 A G X: 107,293,064 T161A probably benign Het
Heatr1 G T 13: 12,434,460 L1946F probably damaging Het
Inpp5k T C 11: 75,647,686 L461P probably damaging Het
Isy1 T C 6: 87,821,545 E209G possibly damaging Het
Kdm5b A G 1: 134,630,542 H1429R probably benign Het
Magi2 C T 5: 20,465,909 T580M probably damaging Het
Map3k1 C T 13: 111,756,220 V834I probably benign Het
Mdn1 A T 4: 32,720,818 E2310D probably benign Het
Myo15 A T 11: 60,477,572 Y386F probably damaging Het
Neurod1 T A 2: 79,454,595 N148I probably damaging Het
Nsa2 G T 13: 97,135,534 Q60K possibly damaging Het
Pcdha1 T A 18: 36,930,802 L173Q probably damaging Het
Pdpk1 T C 17: 24,110,850 T71A possibly damaging Het
Plxna2 T A 1: 194,807,521 V1692E probably damaging Het
Pmepa1 G A 2: 173,228,133 R210W probably damaging Het
Psg27 T A 7: 18,560,354 Q376L probably damaging Het
Psmd4 T C 3: 95,035,251 D6G possibly damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rala T A 13: 17,882,446 E185V probably benign Het
Sall4 A G 2: 168,756,123 S266P probably damaging Het
Scn10a T C 9: 119,691,562 T91A probably damaging Het
Synrg T C 11: 84,001,920 F613S probably damaging Het
Tekt1 A G 11: 72,344,894 I376T probably damaging Het
Tet2 T C 3: 133,479,363 K1182R possibly damaging Het
Thbs4 T C 13: 92,773,164 N375S probably benign Het
Thoc5 A G 11: 4,920,372 probably benign Het
Tmprss9 G T 10: 80,887,467 V254F probably damaging Het
Ttbk2 A T 2: 120,773,815 probably benign Het
Usf2 A G 7: 30,955,831 V133A probably benign Het
Wap G A 11: 6,638,550 Q25* probably null Het
Xdh C T 17: 73,893,595 probably benign Het
Xrn1 G T 9: 95,969,285 M153I probably benign Het
Other mutations in Tro
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00772:Tro APN X 150655325 missense probably benign 0.45
IGL00818:Tro APN X 150648361 missense probably damaging 1.00
IGL03170:Tro APN X 150655560 missense probably benign 0.36
R0022:Tro UTSW X 150647512 intron probably benign
R0049:Tro UTSW X 150654569 missense possibly damaging 0.56
R1378:Tro UTSW X 150655571 missense probably damaging 1.00
R2228:Tro UTSW X 150655481 missense probably benign 0.17
R3080:Tro UTSW X 150655202 missense probably benign 0.09
R3437:Tro UTSW X 150646256 intron probably benign
R3715:Tro UTSW X 150654234 missense probably damaging 1.00
R3787:Tro UTSW X 150655052 missense possibly damaging 0.83
R3840:Tro UTSW X 150646202 intron probably benign
R4001:Tro UTSW X 150655202 missense probably benign 0.09
R5449:Tro UTSW X 150645970 intron probably benign
R7112:Tro UTSW X 150645856 intron probably benign
R7909:Tro UTSW X 150648624 intron probably benign
Predicted Primers PCR Primer
(F):5'- CAGATGCCCCAATCTGTCTG -3'
(R):5'- AGTGAGGATGCCACTACACAG -3'

Sequencing Primer
(F):5'- AATCTGTCTGCTAGATGCCTCAATGG -3'
(R):5'- GGATGCCACTACACAGCTGAAG -3'
Posted On2015-03-25