Incidental Mutation 'R3784:Klra8'
ID 272168
Institutional Source Beutler Lab
Gene Symbol Klra8
Ensembl Gene ENSMUSG00000089727
Gene Name killer cell lectin-like receptor, subfamily A, member 8
Synonyms Ly49u<129>, Ly49h, Cmv1, Cmv-1
MMRRC Submission 040876-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.051) question?
Stock # R3784 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 130092189-130106861 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 130102018 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 139 (D139V)
Ref Sequence ENSEMBL: ENSMUSP00000014476 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014476]
AlphaFold Q60682
PDB Structure Crystal structure of the activating Ly49H receptor in complex with m157 (G1F strain) [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000014476
AA Change: D139V

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000014476
Gene: ENSMUSG00000089727
AA Change: D139V

DomainStartEndE-ValueType
Blast:CLECT 73 124 9e-8 BLAST
CLECT 143 258 6.53e-15 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (44/44)
MGI Phenotype PHENOTYPE: Most mouse strains other than C57BL/6 and C57BL/10 lack this gene and this correlates with an increased susceptiblity to CMV infection. A congenic strain in which the CMV resistant allele from C57BL/6 mice has been introduced in the BALB/c background shows high susceptibility to malarial infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,684,980 (GRCm39) C172* probably null Het
3110082I17Rik G T 5: 139,441,197 (GRCm39) P35Q probably damaging Het
Adam11 T C 11: 102,665,193 (GRCm39) probably null Het
Ank2 A G 3: 126,746,842 (GRCm39) L581P probably damaging Het
Armc2 T C 10: 41,798,190 (GRCm39) I779V probably benign Het
Atp8a2 A T 14: 60,011,415 (GRCm39) Y965N probably damaging Het
C3 A G 17: 57,533,067 (GRCm39) V146A probably damaging Het
Cfap206 A T 4: 34,716,445 (GRCm39) I340N probably damaging Het
Col3a1 A G 1: 45,386,295 (GRCm39) D145G probably damaging Het
Drosha A G 15: 12,890,615 (GRCm39) D954G possibly damaging Het
Fam161b A T 12: 84,408,464 (GRCm39) probably null Het
Fat2 C T 11: 55,147,012 (GRCm39) A3995T probably benign Het
Foxg1 A G 12: 49,432,382 (GRCm39) T372A probably benign Het
Heatr1 G T 13: 12,449,341 (GRCm39) L1946F probably damaging Het
Hook1 T C 4: 95,877,888 (GRCm39) F55L probably damaging Het
Iars2 T C 1: 185,019,328 (GRCm39) K986R probably benign Het
Inpp5k T C 11: 75,538,512 (GRCm39) L461P probably damaging Het
Mical3 T C 6: 120,998,298 (GRCm39) Y20C probably benign Het
Myo15a A T 11: 60,368,398 (GRCm39) Y386F probably damaging Het
Ncoa6 G A 2: 155,249,677 (GRCm39) T1209I probably damaging Het
Nsa2 G T 13: 97,272,042 (GRCm39) Q60K possibly damaging Het
Olfml2b A G 1: 170,509,551 (GRCm39) D633G probably damaging Het
Plekhg3 T C 12: 76,607,294 (GRCm39) probably null Het
Plxna2 T A 1: 194,326,925 (GRCm39) D286E probably benign Het
Pmepa1 G A 2: 173,069,926 (GRCm39) R210W probably damaging Het
Prmt7 C A 8: 106,968,768 (GRCm39) Q361K probably benign Het
Prrc2c T C 1: 162,537,238 (GRCm39) probably benign Het
Psg27 T A 7: 18,294,279 (GRCm39) Q376L probably damaging Het
Ptch1 T G 13: 63,672,773 (GRCm39) E944A probably benign Het
Rad51b C T 12: 79,347,419 (GRCm39) Q28* probably null Het
Rala T A 13: 18,057,031 (GRCm39) E185V probably benign Het
Sall4 A G 2: 168,598,043 (GRCm39) S266P probably damaging Het
Senp6 T G 9: 79,999,568 (GRCm39) I74S probably benign Het
Spats2l A G 1: 57,924,938 (GRCm39) E112G probably damaging Het
Synrg T C 11: 83,892,746 (GRCm39) F613S probably damaging Het
Taf15 G A 11: 83,397,248 (GRCm39) D313N unknown Het
Tekt1 A G 11: 72,235,720 (GRCm39) I376T probably damaging Het
Thbs4 T C 13: 92,909,672 (GRCm39) N375S probably benign Het
Tubb6 A G 18: 67,526,063 (GRCm39) T72A possibly damaging Het
Txndc16 A T 14: 45,403,343 (GRCm39) V32E probably damaging Het
Vmn1r200 A T 13: 22,580,025 (GRCm39) Y276F possibly damaging Het
Other mutations in Klra8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01363:Klra8 APN 6 130,092,561 (GRCm39) missense probably benign
IGL01786:Klra8 APN 6 130,096,031 (GRCm39) critical splice acceptor site probably null
IGL02145:Klra8 APN 6 130,102,199 (GRCm39) missense probably benign 0.01
IGL02531:Klra8 APN 6 130,095,933 (GRCm39) missense possibly damaging 0.67
P4748:Klra8 UTSW 6 130,099,007 (GRCm39) missense possibly damaging 0.51
R0082:Klra8 UTSW 6 130,102,018 (GRCm39) missense probably benign 0.00
R0853:Klra8 UTSW 6 130,095,977 (GRCm39) missense probably damaging 1.00
R1517:Klra8 UTSW 6 130,092,603 (GRCm39) missense probably benign 0.02
R1610:Klra8 UTSW 6 130,095,981 (GRCm39) missense probably damaging 1.00
R1669:Klra8 UTSW 6 130,092,592 (GRCm39) nonsense probably null
R2015:Klra8 UTSW 6 130,092,536 (GRCm39) missense probably damaging 1.00
R6909:Klra8 UTSW 6 130,102,123 (GRCm39) missense probably benign 0.03
R7009:Klra8 UTSW 6 130,102,147 (GRCm39) missense probably benign 0.02
R8443:Klra8 UTSW 6 130,105,056 (GRCm39) missense probably damaging 0.98
R9055:Klra8 UTSW 6 130,096,017 (GRCm39) missense probably benign 0.00
X0013:Klra8 UTSW 6 130,102,082 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGTGCCAAAGAGAACTTTCCTTC -3'
(R):5'- TGTTGGCTCTCCACGTGAAG -3'

Sequencing Primer
(F):5'- CATCTGAAGCTGCTGGAT -3'
(R):5'- ACGTGAAGCCTATTCTCTAACC -3'
Posted On 2015-03-25