Incidental Mutation 'R3785:Slc13a4'
ID272210
Institutional Source Beutler Lab
Gene Symbol Slc13a4
Ensembl Gene ENSMUSG00000029843
Gene Namesolute carrier family 13 (sodium/sulfate symporters), member 4
Synonyms9630060C05Rik, SUT1, SUT-1
MMRRC Submission 040752-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.813) question?
Stock #R3785 (G1)
Quality Score209
Status Validated
Chromosome6
Chromosomal Location35267957-35308131 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 35287892 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 131 (T131S)
Ref Sequence ENSEMBL: ENSMUSP00000031868 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031868]
Predicted Effect probably damaging
Transcript: ENSMUST00000031868
AA Change: T131S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000031868
Gene: ENSMUSG00000029843
AA Change: T131S

DomainStartEndE-ValueType
Pfam:Na_sulph_symp 5 609 3.2e-105 PFAM
Pfam:CitMHS 45 166 1.1e-15 PFAM
Pfam:CitMHS 251 531 8.9e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122829
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155366
Meta Mutation Damage Score 0.4355 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 95% (38/40)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele display lethality before birth, impaired placental sulfate transport, failure of bone ossification, impaired vascular development, hemorrhaging, and cleft palate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
A2ml1 C T 6: 128,544,924 probably null Het
Aak1 T C 6: 86,965,578 F701S unknown Het
Arid2 T A 15: 96,372,558 D1517E possibly damaging Het
Cyp2r1 C T 7: 114,554,696 V88I possibly damaging Het
Dennd3 T C 15: 73,547,577 V739A possibly damaging Het
Dnah11 G T 12: 118,017,602 Q2610K probably damaging Het
Gm5698 T C 1: 30,977,479 T164A probably benign Het
Gpt2 G T 8: 85,525,573 V506L probably benign Het
Gpx6 A G 13: 21,313,786 T76A probably benign Het
Htra3 A T 5: 35,671,128 L136H probably benign Het
Ifitm10 G A 7: 142,328,598 T145I possibly damaging Het
Inpp5k T C 11: 75,647,686 L461P probably damaging Het
Kcnd3 C A 3: 105,668,225 T555K possibly damaging Het
Kif13b C T 14: 64,800,400 T1505I probably benign Het
Mcf2l G T 8: 12,880,099 G40C probably damaging Het
Mettl3 A T 14: 52,299,906 I102N probably benign Het
Muc5b C T 7: 141,865,116 T3933I possibly damaging Het
Mus81 G A 19: 5,485,361 probably benign Het
Myo15 A T 11: 60,477,572 Y386F probably damaging Het
Mypn C A 10: 63,193,182 R34L probably benign Het
Neurod1 T A 2: 79,454,595 N148I probably damaging Het
Olfr1012 G A 2: 85,759,453 P308S probably benign Het
Olfr1305 T C 2: 111,873,486 Y123C probably damaging Het
Olfr951 T C 9: 39,394,382 V197A probably benign Het
Pmepa1 G A 2: 173,228,133 R210W probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rnf5 A G 17: 34,601,932 probably null Het
Sacs C A 14: 61,183,961 Q116K probably damaging Het
Sall4 A G 2: 168,756,123 S266P probably damaging Het
Senp6 T G 9: 80,092,286 I74S probably benign Het
Slc9a4 C A 1: 40,583,970 P123Q probably damaging Het
Stxbp4 T A 11: 90,535,615 probably null Het
Swt1 T C 1: 151,379,404 D814G probably benign Het
Synrg T C 11: 84,001,920 F613S probably damaging Het
Tekt1 A G 11: 72,344,894 I376T probably damaging Het
Ttbk2 A T 2: 120,773,815 probably benign Het
Txnl4b C T 8: 109,572,777 A123V probably damaging Het
Wap G A 11: 6,638,550 Q25* probably null Het
Zfp26 A T 9: 20,437,802 C489S probably damaging Het
Zfp804b G A 5: 6,770,153 T934M possibly damaging Het
Other mutations in Slc13a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Slc13a4 APN 6 35289824 missense probably benign 0.01
IGL00975:Slc13a4 APN 6 35274975 missense probably benign 0.18
IGL01069:Slc13a4 APN 6 35268882 missense probably damaging 1.00
IGL01319:Slc13a4 APN 6 35307353 splice site probably null
IGL01560:Slc13a4 APN 6 35271603 splice site probably benign
IGL02125:Slc13a4 APN 6 35278288 missense probably benign 0.23
IGL02415:Slc13a4 APN 6 35283237 critical splice donor site probably null
IGL02888:Slc13a4 APN 6 35268840 missense probably benign 0.10
R0047:Slc13a4 UTSW 6 35287362 missense possibly damaging 0.84
R0047:Slc13a4 UTSW 6 35287362 missense possibly damaging 0.84
R0532:Slc13a4 UTSW 6 35287404 splice site probably null
R0747:Slc13a4 UTSW 6 35278328 missense probably damaging 1.00
R1391:Slc13a4 UTSW 6 35271662 missense probably damaging 0.96
R2106:Slc13a4 UTSW 6 35287864 missense probably damaging 0.99
R2253:Slc13a4 UTSW 6 35280483 missense probably benign 0.00
R3195:Slc13a4 UTSW 6 35268926 missense probably damaging 1.00
R3689:Slc13a4 UTSW 6 35268910 missense possibly damaging 0.87
R3698:Slc13a4 UTSW 6 35274957 missense probably benign 0.06
R3856:Slc13a4 UTSW 6 35271604 splice site probably null
R5400:Slc13a4 UTSW 6 35301842 nonsense probably null
R6142:Slc13a4 UTSW 6 35301783 missense probably damaging 0.99
R6645:Slc13a4 UTSW 6 35268839 missense probably benign 0.19
R6851:Slc13a4 UTSW 6 35301733 missense probably damaging 1.00
R7200:Slc13a4 UTSW 6 35287350 missense possibly damaging 0.56
R7513:Slc13a4 UTSW 6 35283337 intron probably null
R7590:Slc13a4 UTSW 6 35279463 missense possibly damaging 0.90
R7673:Slc13a4 UTSW 6 35276476 missense probably damaging 1.00
R7706:Slc13a4 UTSW 6 35270355 missense possibly damaging 0.92
R8056:Slc13a4 UTSW 6 35268952 missense probably damaging 1.00
Z1176:Slc13a4 UTSW 6 35278292 missense probably damaging 0.96
Z1177:Slc13a4 UTSW 6 35289849 missense possibly damaging 0.75
Z1177:Slc13a4 UTSW 6 35289850 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCTCCAATGAAGATGGGCAC -3'
(R):5'- TTTTCCTGGCCATGGTCACTAG -3'

Sequencing Primer
(F):5'- CAGTGAACTGTACCCATGAG -3'
(R):5'- ATGGTCACTAGCCACGGC -3'
Posted On2015-03-25