Incidental Mutation 'R3785:A2ml1'
ID272212
Institutional Source Beutler Lab
Gene Symbol A2ml1
Ensembl Gene ENSMUSG00000047228
Gene Namealpha-2-macroglobulin like 1
Synonyms
MMRRC Submission 040752-MU
Accession Numbers

Genbank: NM_001001179.3; Ensembl: ENSMUST00000060574

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3785 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location128539821-128581608 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 128544924 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000059426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060574]
Predicted Effect probably null
Transcript: ENSMUST00000060574
SMART Domains Protein: ENSMUSP00000059426
Gene: ENSMUSG00000047228

DomainStartEndE-ValueType
low complexity region 42 58 N/A INTRINSIC
Pfam:A2M_N 120 213 6.3e-17 PFAM
A2M_N_2 448 594 2.95e-37 SMART
A2M 736 826 2.11e-33 SMART
Pfam:Thiol-ester_cl 959 988 3.1e-17 PFAM
Pfam:A2M_comp 1008 1255 2.3e-71 PFAM
A2M_recep 1361 1447 1.22e-29 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203291
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205167
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 95% (38/40)
Allele List at MGI

All alleles(2) : Gene trapped(2)

Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Aak1 T C 6: 86,965,578 F701S unknown Het
Arid2 T A 15: 96,372,558 D1517E possibly damaging Het
Cyp2r1 C T 7: 114,554,696 V88I possibly damaging Het
Dennd3 T C 15: 73,547,577 V739A possibly damaging Het
Dnah11 G T 12: 118,017,602 Q2610K probably damaging Het
Gm5698 T C 1: 30,977,479 T164A probably benign Het
Gpt2 G T 8: 85,525,573 V506L probably benign Het
Gpx6 A G 13: 21,313,786 T76A probably benign Het
Htra3 A T 5: 35,671,128 L136H probably benign Het
Ifitm10 G A 7: 142,328,598 T145I possibly damaging Het
Inpp5k T C 11: 75,647,686 L461P probably damaging Het
Kcnd3 C A 3: 105,668,225 T555K possibly damaging Het
Kif13b C T 14: 64,800,400 T1505I probably benign Het
Mcf2l G T 8: 12,880,099 G40C probably damaging Het
Mettl3 A T 14: 52,299,906 I102N probably benign Het
Muc5b C T 7: 141,865,116 T3933I possibly damaging Het
Mus81 G A 19: 5,485,361 probably benign Het
Myo15 A T 11: 60,477,572 Y386F probably damaging Het
Mypn C A 10: 63,193,182 R34L probably benign Het
Neurod1 T A 2: 79,454,595 N148I probably damaging Het
Olfr1012 G A 2: 85,759,453 P308S probably benign Het
Olfr1305 T C 2: 111,873,486 Y123C probably damaging Het
Olfr951 T C 9: 39,394,382 V197A probably benign Het
Pmepa1 G A 2: 173,228,133 R210W probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rnf5 A G 17: 34,601,932 probably null Het
Sacs C A 14: 61,183,961 Q116K probably damaging Het
Sall4 A G 2: 168,756,123 S266P probably damaging Het
Senp6 T G 9: 80,092,286 I74S probably benign Het
Slc13a4 T A 6: 35,287,892 T131S probably damaging Het
Slc9a4 C A 1: 40,583,970 P123Q probably damaging Het
Stxbp4 T A 11: 90,535,615 probably null Het
Swt1 T C 1: 151,379,404 D814G probably benign Het
Synrg T C 11: 84,001,920 F613S probably damaging Het
Tekt1 A G 11: 72,344,894 I376T probably damaging Het
Ttbk2 A T 2: 120,773,815 probably benign Het
Txnl4b C T 8: 109,572,777 A123V probably damaging Het
Wap G A 11: 6,638,550 Q25* probably null Het
Zfp26 A T 9: 20,437,802 C489S probably damaging Het
Zfp804b G A 5: 6,770,153 T934M possibly damaging Het
Other mutations in A2ml1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00513:A2ml1 APN 6 128578156 missense possibly damaging 0.78
IGL00596:A2ml1 APN 6 128570067 missense probably damaging 0.99
IGL00912:A2ml1 APN 6 128552307 missense probably benign 0.04
IGL01320:A2ml1 APN 6 128575588 missense probably benign 0.00
IGL01470:A2ml1 APN 6 128580412 missense probably damaging 0.96
IGL01576:A2ml1 APN 6 128554330 splice site probably benign
IGL01761:A2ml1 APN 6 128546337 missense possibly damaging 0.61
IGL01792:A2ml1 APN 6 128560679 missense probably benign 0.04
IGL01843:A2ml1 APN 6 128553338 splice site probably benign
IGL01946:A2ml1 APN 6 128570479 missense possibly damaging 0.81
IGL02016:A2ml1 APN 6 128558335 missense probably damaging 1.00
IGL02170:A2ml1 APN 6 128547210 missense possibly damaging 0.58
IGL02269:A2ml1 APN 6 128553338 splice site probably benign
IGL02589:A2ml1 APN 6 128581500 missense probably benign 0.00
IGL02959:A2ml1 APN 6 128567060 missense probably benign 0.04
IGL02970:A2ml1 APN 6 128569979 missense probably damaging 1.00
IGL03206:A2ml1 APN 6 128553276 missense possibly damaging 0.50
IGL03298:A2ml1 APN 6 128543960 missense probably benign 0.00
1mM(1):A2ml1 UTSW 6 128580960 missense probably benign 0.02
R0055:A2ml1 UTSW 6 128570094 splice site probably benign
R0055:A2ml1 UTSW 6 128570094 splice site probably benign
R0069:A2ml1 UTSW 6 128561562 missense probably damaging 1.00
R0069:A2ml1 UTSW 6 128561562 missense probably damaging 1.00
R0128:A2ml1 UTSW 6 128575639 splice site probably benign
R0299:A2ml1 UTSW 6 128553232 splice site probably benign
R0523:A2ml1 UTSW 6 128558326 missense possibly damaging 0.92
R0565:A2ml1 UTSW 6 128568743 nonsense probably null
R0599:A2ml1 UTSW 6 128552245 missense probably damaging 1.00
R0626:A2ml1 UTSW 6 128550773 missense probably damaging 0.99
R0732:A2ml1 UTSW 6 128546448 missense probably damaging 1.00
R0880:A2ml1 UTSW 6 128560646 missense possibly damaging 0.49
R1070:A2ml1 UTSW 6 128543300 missense probably damaging 1.00
R1166:A2ml1 UTSW 6 128570917 missense probably benign 0.00
R1278:A2ml1 UTSW 6 128558507 missense probably damaging 1.00
R1421:A2ml1 UTSW 6 128543960 missense probably benign 0.00
R1536:A2ml1 UTSW 6 128547233 nonsense probably null
R1786:A2ml1 UTSW 6 128576260 missense probably damaging 1.00
R1808:A2ml1 UTSW 6 128543299 missense probably damaging 1.00
R1813:A2ml1 UTSW 6 128566273 missense probably benign 0.34
R1863:A2ml1 UTSW 6 128550783 missense probably damaging 0.99
R2007:A2ml1 UTSW 6 128542892 missense probably benign 0.13
R2062:A2ml1 UTSW 6 128552308 missense probably benign 0.08
R2127:A2ml1 UTSW 6 128558437 missense probably damaging 1.00
R2130:A2ml1 UTSW 6 128576260 missense probably damaging 1.00
R2131:A2ml1 UTSW 6 128576260 missense probably damaging 1.00
R2201:A2ml1 UTSW 6 128547305 missense probably null 0.34
R2319:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R2321:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R2322:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R2369:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R2370:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R2371:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R2372:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R2375:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R2893:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R2894:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R3438:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R3615:A2ml1 UTSW 6 128558294 missense probably benign 0.07
R3616:A2ml1 UTSW 6 128558294 missense probably benign 0.07
R3773:A2ml1 UTSW 6 128555083 missense probably benign 0.02
R3803:A2ml1 UTSW 6 128545070 missense probably benign 0.17
R3824:A2ml1 UTSW 6 128568763 missense probably damaging 0.99
R3878:A2ml1 UTSW 6 128554361 missense probably benign 0.05
R4176:A2ml1 UTSW 6 128545037 missense possibly damaging 0.68
R4229:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R4230:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R4348:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R4351:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R4352:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R4353:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R4427:A2ml1 UTSW 6 128545046 missense probably benign 0.00
R4971:A2ml1 UTSW 6 128547227 missense probably damaging 0.98
R5014:A2ml1 UTSW 6 128543933 missense probably benign 0.00
R5369:A2ml1 UTSW 6 128568833 missense probably damaging 0.97
R5532:A2ml1 UTSW 6 128553330 critical splice acceptor site probably null
R5860:A2ml1 UTSW 6 128541061 missense probably benign 0.15
R5872:A2ml1 UTSW 6 128561526 missense probably damaging 1.00
R5926:A2ml1 UTSW 6 128560645 missense probably benign
R5977:A2ml1 UTSW 6 128581122 missense probably damaging 1.00
R5980:A2ml1 UTSW 6 128567055 missense possibly damaging 0.82
R6014:A2ml1 UTSW 6 128571985 missense probably damaging 1.00
R6032:A2ml1 UTSW 6 128549836 nonsense probably null
R6032:A2ml1 UTSW 6 128549836 nonsense probably null
R6061:A2ml1 UTSW 6 128568712 missense probably damaging 1.00
R6327:A2ml1 UTSW 6 128558692 unclassified probably null
R6331:A2ml1 UTSW 6 128552236 missense probably damaging 0.96
R6465:A2ml1 UTSW 6 128541078 missense probably damaging 1.00
R6640:A2ml1 UTSW 6 128553285 missense probably benign 0.41
R6792:A2ml1 UTSW 6 128546329 nonsense probably null
R6793:A2ml1 UTSW 6 128546329 nonsense probably null
R7207:A2ml1 UTSW 6 128550771 missense probably benign 0.04
R7378:A2ml1 UTSW 6 128546247 critical splice donor site probably null
R7556:A2ml1 UTSW 6 128569964 missense probably damaging 1.00
R8010:A2ml1 UTSW 6 128580340 missense probably benign 0.08
R8017:A2ml1 UTSW 6 128581447 critical splice donor site probably null
R8019:A2ml1 UTSW 6 128581447 critical splice donor site probably null
R8035:A2ml1 UTSW 6 128553280 missense probably damaging 0.99
R8094:A2ml1 UTSW 6 128572082 missense probably damaging 1.00
R8144:A2ml1 UTSW 6 128569999 missense possibly damaging 0.84
RF014:A2ml1 UTSW 6 128570068 missense probably damaging 0.96
X0063:A2ml1 UTSW 6 128572012 missense probably benign
Z1176:A2ml1 UTSW 6 128571977 missense probably benign 0.09
Z1177:A2ml1 UTSW 6 128545076 missense probably benign
Z1177:A2ml1 UTSW 6 128561616 nonsense probably null
Z1177:A2ml1 UTSW 6 128575607 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- GGAAACTTATTACTCCGTATGCC -3'
(R):5'- GTTAACCGGCTCTAACCCTC -3'

Sequencing Primer
(F):5'- CCACATAGTGATGTTCAGTGCTGAC -3'
(R):5'- GTTAACCGGCTCTAACCCTCAAAAC -3'
Posted On2015-03-25